Incidental Mutation 'R6010:Chil4'
ID 479690
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Name chitinase-like 4
Synonyms Chi3l4, Ym2
MMRRC Submission 044187-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6010 (G1)
Quality Score 109.008
Status Validated
Chromosome 3
Chromosomal Location 106108807-106126795 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106121711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 46 (I46T)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
AlphaFold Q91Z98
Predicted Effect probably damaging
Transcript: ENSMUST00000082219
AA Change: I46T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: I46T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196128
Meta Mutation Damage Score 0.5577 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 (GRCm39) I132M possibly damaging Het
Agap2 A T 10: 126,926,779 (GRCm39) I939F probably damaging Het
Ahctf1 A G 1: 179,623,378 (GRCm39) V80A possibly damaging Het
Atxn3 T C 12: 101,914,285 (GRCm39) D67G probably damaging Het
Avl9 G A 6: 56,730,375 (GRCm39) V573M possibly damaging Het
Baz1b G A 5: 135,246,305 (GRCm39) E585K possibly damaging Het
Brms1l T C 12: 55,914,985 (GRCm39) F298S possibly damaging Het
Camk2d G A 3: 126,591,363 (GRCm39) V278I possibly damaging Het
Car10 A G 11: 93,490,149 (GRCm39) I297V possibly damaging Het
Cfap65 C T 1: 74,962,190 (GRCm39) C677Y probably damaging Het
Cfap74 T A 4: 155,538,495 (GRCm39) D872E possibly damaging Het
Cgrrf1 A C 14: 47,091,158 (GRCm39) Q227H probably damaging Het
Chpf2 A T 5: 24,796,917 (GRCm39) H621L probably damaging Het
Cluap1 C T 16: 3,755,437 (GRCm39) R351W possibly damaging Het
Cnot6 A T 11: 49,574,066 (GRCm39) Y201* probably null Het
Col15a1 T C 4: 47,245,630 (GRCm39) V127A probably benign Het
Col6a3 C T 1: 90,701,219 (GRCm39) V2566I unknown Het
Cope T A 8: 70,761,162 (GRCm39) M88K probably damaging Het
Cops4 A G 5: 100,691,776 (GRCm39) I358M possibly damaging Het
Coro7 T C 16: 4,487,820 (GRCm39) E130G possibly damaging Het
Csrp3 A G 7: 48,485,213 (GRCm39) probably null Het
Cyp4f39 T C 17: 32,701,160 (GRCm39) F217L probably damaging Het
Dmac1 A G 4: 75,196,473 (GRCm39) S6P unknown Het
Drd4 A T 7: 140,874,709 (GRCm39) I367F probably damaging Het
Efcc1 T A 6: 87,730,711 (GRCm39) probably null Het
Emid1 A T 11: 5,085,389 (GRCm39) M119K possibly damaging Het
Fbn2 C T 18: 58,202,596 (GRCm39) D1237N probably benign Het
Fbxl18 C A 5: 142,858,153 (GRCm39) R761L probably damaging Het
Gbp10 A C 5: 105,372,205 (GRCm39) L185R probably damaging Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Gucd1 G T 10: 75,256,600 (GRCm39) probably benign Het
Helb G A 10: 119,941,788 (GRCm39) T300M probably damaging Het
Ifna11 A T 4: 88,738,278 (GRCm39) H28L probably benign Het
Kalrn T A 16: 33,830,950 (GRCm39) N723I probably benign Het
Kcnb2 C T 1: 15,780,790 (GRCm39) S554F possibly damaging Het
Med1 A C 11: 98,049,188 (GRCm39) V536G probably damaging Het
Nanog A C 6: 122,690,255 (GRCm39) N195T probably benign Het
Neu1 C T 17: 35,151,031 (GRCm39) S94F probably damaging Het
Nop58 T A 1: 59,740,071 (GRCm39) S154R probably damaging Het
Npl A T 1: 153,388,314 (GRCm39) L239* probably null Het
Nrg1 G A 8: 32,308,600 (GRCm39) T483M probably damaging Het
Nup98 G T 7: 101,829,636 (GRCm39) F391L probably damaging Het
Or4c122 A T 2: 89,079,087 (GRCm39) I305K probably benign Het
Or5ar1 T C 2: 85,671,905 (GRCm39) I77V probably benign Het
Or5d47 A T 2: 87,804,886 (GRCm39) V41E probably damaging Het
Or5g26 T C 2: 85,494,374 (GRCm39) I135V probably benign Het
Pacsin2 A G 15: 83,266,020 (GRCm39) V59A possibly damaging Het
Pcsk9 C T 4: 106,311,469 (GRCm39) R254H possibly damaging Het
Pierce2 A T 9: 72,887,488 (GRCm39) probably null Het
Psme2 C A 14: 55,824,980 (GRCm39) probably null Het
Ptprc T A 1: 138,028,794 (GRCm39) H468L probably benign Het
Rbp3 T A 14: 33,676,604 (GRCm39) I184N probably damaging Het
Serpinb1c A G 13: 33,066,042 (GRCm39) L301P probably damaging Het
Smim6 G T 11: 115,804,219 (GRCm39) G2V probably damaging Het
Snrpb2 A G 2: 142,912,815 (GRCm39) D146G possibly damaging Het
Svep1 T A 4: 58,115,832 (GRCm39) S954C possibly damaging Het
Telo2 G T 17: 25,323,852 (GRCm39) T568N possibly damaging Het
Tpp2 T C 1: 43,990,373 (GRCm39) probably null Het
Upf1 A G 8: 70,789,675 (GRCm39) V720A probably damaging Het
Vmn1r81 T C 7: 11,994,349 (GRCm39) I86M possibly damaging Het
Vps8 T A 16: 21,363,955 (GRCm39) probably benign Het
Wdr70 T C 15: 7,916,900 (GRCm39) probably null Het
Zfp385c A T 11: 100,548,363 (GRCm39) S30T probably benign Het
Zfp607a T A 7: 27,577,254 (GRCm39) L108* probably null Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106,109,113 (GRCm39) missense probably benign
IGL02457:Chil4 APN 3 106,121,715 (GRCm39) missense probably benign
R1087:Chil4 UTSW 3 106,117,881 (GRCm39) missense probably benign 0.01
R1398:Chil4 UTSW 3 106,126,825 (GRCm39) splice site probably null
R1503:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign
R1553:Chil4 UTSW 3 106,111,006 (GRCm39) missense probably benign 0.02
R1806:Chil4 UTSW 3 106,117,959 (GRCm39) splice site probably benign
R1873:Chil4 UTSW 3 106,113,414 (GRCm39) missense probably benign 0.00
R2069:Chil4 UTSW 3 106,126,771 (GRCm39) missense probably benign 0.16
R2100:Chil4 UTSW 3 106,121,663 (GRCm39) missense probably benign
R2370:Chil4 UTSW 3 106,121,616 (GRCm39) nonsense probably null
R2984:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106,111,056 (GRCm39) missense probably benign 0.08
R3919:Chil4 UTSW 3 106,109,848 (GRCm39) missense probably benign 0.00
R4033:Chil4 UTSW 3 106,121,765 (GRCm39) missense probably damaging 1.00
R4181:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106,110,144 (GRCm39) missense probably benign
R4391:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106,121,678 (GRCm39) missense probably damaging 1.00
R4544:Chil4 UTSW 3 106,117,922 (GRCm39) missense probably damaging 0.97
R4887:Chil4 UTSW 3 106,111,460 (GRCm39) missense probably benign 0.01
R4949:Chil4 UTSW 3 106,113,408 (GRCm39) missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106,109,913 (GRCm39) missense probably damaging 1.00
R5146:Chil4 UTSW 3 106,110,150 (GRCm39) missense probably benign 0.18
R5254:Chil4 UTSW 3 106,126,768 (GRCm39) missense probably benign 0.00
R5521:Chil4 UTSW 3 106,111,013 (GRCm39) missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106,109,894 (GRCm39) missense probably benign 0.00
R5883:Chil4 UTSW 3 106,117,886 (GRCm39) missense possibly damaging 0.48
R6257:Chil4 UTSW 3 106,111,412 (GRCm39) missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106,111,487 (GRCm39) missense probably damaging 1.00
R6602:Chil4 UTSW 3 106,117,906 (GRCm39) missense probably benign 0.00
R7113:Chil4 UTSW 3 106,121,664 (GRCm39) missense probably benign
R7113:Chil4 UTSW 3 106,110,083 (GRCm39) missense probably damaging 1.00
R7188:Chil4 UTSW 3 106,111,475 (GRCm39) missense probably damaging 1.00
R7980:Chil4 UTSW 3 106,110,060 (GRCm39) missense probably damaging 1.00
R8810:Chil4 UTSW 3 106,109,121 (GRCm39) missense probably damaging 0.99
R9300:Chil4 UTSW 3 106,109,874 (GRCm39) missense probably benign 0.10
R9307:Chil4 UTSW 3 106,111,382 (GRCm39) critical splice donor site probably null
R9529:Chil4 UTSW 3 106,118,656 (GRCm39) missense probably damaging 1.00
X0067:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGTGGTTATGAGACATTCAGAGG -3'
(R):5'- CTGACTAGAAAATGGCTGATGC -3'

Sequencing Primer
(F):5'- AGCCTGTCTCAATTTAAAACTGAAG -3'
(R):5'- TGGCTGATGCTAAATAAGTAAGATC -3'
Posted On 2017-06-26