Incidental Mutation 'R6010:Camk2d'
ID479691
Institutional Source Beutler Lab
Gene Symbol Camk2d
Ensembl Gene ENSMUSG00000053819
Gene Namecalcium/calmodulin-dependent protein kinase II, delta
SynonymsCaMK II, 2810011D23Rik, 8030469K03Rik
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location126596302-126846326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126797714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 278 (V278I)
Ref Sequence ENSEMBL: ENSMUSP00000133019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066466] [ENSMUST00000106399] [ENSMUST00000106400] [ENSMUST00000106401] [ENSMUST00000106402] [ENSMUST00000134466] [ENSMUST00000145454] [ENSMUST00000163226] [ENSMUST00000171289] [ENSMUST00000199300] [ENSMUST00000200171]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066466
AA Change: V278I

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063359
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 7.4e-67 PFAM
Pfam:DUF4440 350 464 4.7e-13 PFAM
Pfam:SnoaL_3 350 476 3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106399
AA Change: V278I

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102007
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 357 484 3.5e-67 PFAM
Pfam:DUF4440 361 475 5.4e-13 PFAM
Pfam:SnoaL_3 361 487 3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106400
AA Change: V278I

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102008
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 4.7e-67 PFAM
Pfam:DUF4440 350 464 3.2e-13 PFAM
Pfam:SnoaL_3 350 476 2.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106401
AA Change: V278I

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102009
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.8e-67 PFAM
Pfam:DUF4440 384 498 5.8e-13 PFAM
Pfam:SnoaL_3 384 510 3.2e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106402
AA Change: V278I

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102010
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 1.1e-66 PFAM
Pfam:DUF4440 384 498 8.1e-13 PFAM
Pfam:SnoaL_3 384 510 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131869
SMART Domains Protein: ENSMUSP00000126412
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 1 109 5.1e-26 PFAM
Pfam:Pkinase_Tyr 3 111 4.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134466
SMART Domains Protein: ENSMUSP00000114801
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1e-33 PFAM
Pfam:Pkinase_Tyr 14 141 4.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145454
SMART Domains Protein: ENSMUSP00000130769
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:Pkinase 14 140 1.4e-33 PFAM
Pfam:Pkinase_Tyr 14 142 4.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147043
Predicted Effect possibly damaging
Transcript: ENSMUST00000163226
AA Change: V278I

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133019
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167417
SMART Domains Protein: ENSMUSP00000131124
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:CaMKII_AD 53 180 4.8e-68 PFAM
Pfam:DUF4440 57 171 8.2e-14 PFAM
Pfam:SnoaL_3 57 183 4.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167985
SMART Domains Protein: ENSMUSP00000126207
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
Pfam:CaMKII_AD 59 130 2.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169051
SMART Domains Protein: ENSMUSP00000132554
Gene: ENSMUSG00000053819

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 6.9e-67 PFAM
Pfam:DUF4440 350 464 4.3e-13 PFAM
Pfam:SnoaL_3 350 476 2.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171289
AA Change: V278I

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129999
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 1.33e-110 SMART
Pfam:CaMKII_AD 380 507 3.3e-63 PFAM
Pfam:DUF4440 384 498 3.2e-12 PFAM
Pfam:SnoaL_3 384 509 8.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199300
AA Change: V278I

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143504
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 346 473 1.3e-62 PFAM
Pfam:DUF4440 350 464 1.7e-11 PFAM
Pfam:SnoaL_3 350 475 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200171
AA Change: V278I

PolyPhen 2 Score 0.234 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143677
Gene: ENSMUSG00000053819
AA Change: V278I

DomainStartEndE-ValueType
S_TKc 14 272 9.91e-110 SMART
Pfam:CaMKII_AD 380 507 9.8e-63 PFAM
Pfam:DUF4440 384 498 2.5e-11 PFAM
Pfam:SnoaL_3 384 509 5.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198487
Meta Mutation Damage Score 0.1318 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced response to heart induced stress. Mice homozygous for an allele that produces an oxidant-resistant product exhibit reduced response to myocardial infarction in a diabetic model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Camk2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Camk2d APN 3 126838272 nonsense probably null
IGL01113:Camk2d APN 3 126780412 missense probably damaging 1.00
IGL01125:Camk2d APN 3 126798285 splice site probably benign
IGL01912:Camk2d APN 3 126810632 splice site probably null
IGL01934:Camk2d APN 3 126834655 splice site probably null
IGL02184:Camk2d APN 3 126797773 missense probably damaging 0.97
IGL02218:Camk2d APN 3 126840153 missense probably benign 0.00
IGL02804:Camk2d APN 3 126797738 missense possibly damaging 0.53
IGL03347:Camk2d APN 3 126796901 missense probably damaging 1.00
IGL03354:Camk2d APN 3 126796966 splice site probably null
baryon UTSW 3 126597482 nonsense probably null
Neutron UTSW 3 126780420 missense probably damaging 1.00
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0024:Camk2d UTSW 3 126797723 missense probably benign 0.01
R0628:Camk2d UTSW 3 126810624 splice site probably benign
R1114:Camk2d UTSW 3 126840292 missense probably damaging 1.00
R1433:Camk2d UTSW 3 126808224 missense probably benign 0.25
R2021:Camk2d UTSW 3 126780456 missense probably damaging 1.00
R2096:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2098:Camk2d UTSW 3 126780442 missense probably damaging 1.00
R2421:Camk2d UTSW 3 126780415 missense probably damaging 1.00
R2437:Camk2d UTSW 3 126834628 missense probably damaging 1.00
R2930:Camk2d UTSW 3 126808231 missense possibly damaging 0.86
R3738:Camk2d UTSW 3 126771839 missense probably damaging 1.00
R3969:Camk2d UTSW 3 126796959 missense possibly damaging 0.81
R4455:Camk2d UTSW 3 126780403 missense probably damaging 1.00
R4829:Camk2d UTSW 3 126779997 intron probably benign
R4916:Camk2d UTSW 3 126783975 missense probably damaging 1.00
R5277:Camk2d UTSW 3 126684741 intron probably benign
R5329:Camk2d UTSW 3 126597482 nonsense probably null
R5364:Camk2d UTSW 3 126780420 missense probably damaging 1.00
R5473:Camk2d UTSW 3 126597399 utr 5 prime probably benign
R5509:Camk2d UTSW 3 126840316 missense probably damaging 1.00
R5958:Camk2d UTSW 3 126779865 intron probably benign
R6145:Camk2d UTSW 3 126805858 missense probably benign
R7267:Camk2d UTSW 3 126797730 missense possibly damaging 0.59
R7708:Camk2d UTSW 3 126597440 start codon destroyed probably benign 0.00
R8249:Camk2d UTSW 3 126797729 missense probably damaging 1.00
R8554:Camk2d UTSW 3 126770799 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGTTTAAGCTCAGTCACTAGC -3'
(R):5'- GCTTGATTATGGAGCATGCTC -3'

Sequencing Primer
(F):5'- CACTAGCAATCTTTATAAAACCATGC -3'
(R):5'- CAGGACTGACTACTGAGATCTATAGC -3'
Posted On2017-06-26