Incidental Mutation 'R6010:Actl7a'
ID479693
Institutional Source Beutler Lab
Gene Symbol Actl7a
Ensembl Gene ENSMUSG00000070979
Gene Nameactin-like 7a
SynonymsTact2, t-actin 2
MMRRC Submission 044187-MU
Accession Numbers

Ncbi RefSeq: NM_009611.3; MGI:1343051

Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location56743413-56744925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56743870 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 132 (I132M)
Ref Sequence ENSEMBL: ENSMUSP00000092692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095079] [ENSMUST00000095080] [ENSMUST00000181745]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095079
AA Change: I132M

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092692
Gene: ENSMUSG00000070979
AA Change: I132M

DomainStartEndE-ValueType
Pfam:ACTL7A_N 6 70 1.3e-39 PFAM
ACTIN 74 440 4.63e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095080
SMART Domains Protein: ENSMUSP00000092693
Gene: ENSMUSG00000070980

DomainStartEndE-ValueType
ACTIN 51 418 1.6e-117 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181745
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7A), and related gene, ACTL7B, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7A gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. The ACTL7A gene is expressed in a wide variety of adult tissues, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Actl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Actl7a APN 4 56743944 missense possibly damaging 0.86
IGL01767:Actl7a APN 4 56743980 missense probably damaging 1.00
IGL02626:Actl7a APN 4 56744353 missense possibly damaging 0.89
R0046:Actl7a UTSW 4 56743877 nonsense probably null
R0046:Actl7a UTSW 4 56743877 nonsense probably null
R1741:Actl7a UTSW 4 56744252 missense probably benign 0.03
R1920:Actl7a UTSW 4 56744135 missense probably damaging 1.00
R2984:Actl7a UTSW 4 56744531 missense probably benign 0.00
R3716:Actl7a UTSW 4 56744295 missense possibly damaging 0.67
R4779:Actl7a UTSW 4 56743632 missense probably benign 0.07
R5391:Actl7a UTSW 4 56743661 missense probably benign
R5540:Actl7a UTSW 4 56744388 missense probably benign 0.00
R5723:Actl7a UTSW 4 56744310 missense probably damaging 0.99
R5902:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R5903:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R5922:Actl7a UTSW 4 56743827 missense probably damaging 1.00
R6786:Actl7a UTSW 4 56744116 nonsense probably null
R7168:Actl7a UTSW 4 56743769 missense probably benign
R7568:Actl7a UTSW 4 56744498 missense probably damaging 1.00
R8230:Actl7a UTSW 4 56743768 missense probably damaging 1.00
R8305:Actl7a UTSW 4 56743744 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GTCAACTATGTCCAAGGATAGGC -3'
(R):5'- GTCTCAAACAGCATCTCGGC -3'

Sequencing Primer
(F):5'- CTATGTCCAAGGATAGGCCAAGAC -3'
(R):5'- AACAGCATCTCGGCGTACTTC -3'
Posted On2017-06-26