Incidental Mutation 'R6010:Nanog'
ID479705
Institutional Source Beutler Lab
Gene Symbol Nanog
Ensembl Gene ENSMUSG00000012396
Gene NameNanog homeobox
Synonyms2410002E02Rik, ecat4, ENK
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122707489-122714633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122713296 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 195 (N195T)
Ref Sequence ENSEMBL: ENSMUSP00000108200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012540] [ENSMUST00000112580] [ENSMUST00000112581]
Predicted Effect probably benign
Transcript: ENSMUST00000012540
AA Change: N220T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000012540
Gene: ENSMUSG00000012396
AA Change: N220T

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
HOX 96 158 5.33e-22 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112580
AA Change: N195T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108199
Gene: ENSMUSG00000012396
AA Change: N195T

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112581
AA Change: N195T

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108200
Gene: ENSMUSG00000012396
AA Change: N195T

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene die between E3.5 and E5.5 with abnormal embryonic and extraembryonic tissue development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Nanog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Nanog APN 6 122711536 critical splice acceptor site probably null
IGL03278:Nanog APN 6 122711745 missense probably damaging 1.00
IGL03387:Nanog APN 6 122711772 missense probably damaging 1.00
R0280:Nanog UTSW 6 122713398 missense probably damaging 0.96
R1443:Nanog UTSW 6 122711775 missense probably damaging 1.00
R2520:Nanog UTSW 6 122713459 missense probably benign 0.08
R3037:Nanog UTSW 6 122713268 missense possibly damaging 0.81
R4486:Nanog UTSW 6 122712717 critical splice donor site probably null
R4770:Nanog UTSW 6 122711591 missense possibly damaging 0.63
R4790:Nanog UTSW 6 122707915 missense probably benign 0.00
R4825:Nanog UTSW 6 122713340 missense probably benign 0.09
R4931:Nanog UTSW 6 122707906 missense possibly damaging 0.95
R6025:Nanog UTSW 6 122713391 missense possibly damaging 0.94
R7661:Nanog UTSW 6 122713472 missense probably damaging 0.96
R8236:Nanog UTSW 6 122713172 missense probably benign
R8272:Nanog UTSW 6 122711777 missense probably benign 0.00
R8520:Nanog UTSW 6 122713516 missense possibly damaging 0.94
X0065:Nanog UTSW 6 122707793 missense probably benign
Z1176:Nanog UTSW 6 122713231 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTTTACATCTTTAGAGTCCCC -3'
(R):5'- AATGCGCATGGCTTTCCCTAG -3'

Sequencing Primer
(F):5'- AGAGTCCCCTTTTCACTCATTG -3'
(R):5'- GTGGCTTCCAAATTCACCTCCAAATC -3'
Posted On2017-06-26