Incidental Mutation 'R6010:Csrp3'
ID479708
Institutional Source Beutler Lab
Gene Symbol Csrp3
Ensembl Gene ENSMUSG00000030470
Gene Namecysteine and glycine-rich protein 3
SynonymsMLP, muscle LIM protein, CRP3
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location48830398-48848033 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 48835465 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032658] [ENSMUST00000167786] [ENSMUST00000208050]
Predicted Effect probably null
Transcript: ENSMUST00000032658
SMART Domains Protein: ENSMUSP00000032658
Gene: ENSMUSG00000030470

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167786
SMART Domains Protein: ENSMUSP00000129378
Gene: ENSMUSG00000030470

DomainStartEndE-ValueType
LIM 9 61 5.87e-12 SMART
LIM 119 171 3.96e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208146
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CSRP family of LIM domain proteins, which may be involved in regulatory processes important for development and cellular differentiation. The LIM/double zinc-finger motif found in this protein is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Mutations in this gene are thought to cause heritable forms of hypertrophic cardiomyopathy (HCM) and dilated cardiomyopathy (DCM) in humans. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit dilated cardiomyopathy characterized by disrupted cardiomyocyte organization that results in premature death, left ventricle dilation, hypertrophy, decreased contractility, and fibrosis. Some homozygotes die postnataly due to heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Csrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Csrp3 APN 7 48830692 missense probably benign 0.24
R1203:Csrp3 UTSW 7 48839530 start codon destroyed probably null 0.97
R4778:Csrp3 UTSW 7 48832563 missense probably damaging 0.98
R5577:Csrp3 UTSW 7 48839477 missense possibly damaging 0.90
R6472:Csrp3 UTSW 7 48835608 missense possibly damaging 0.93
R7214:Csrp3 UTSW 7 48830637 missense probably benign
R7309:Csrp3 UTSW 7 48835569 missense probably benign
R7803:Csrp3 UTSW 7 48833797 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GTCTTCAGAGAGACAACACATTG -3'
(R):5'- CACAGATGTGTTCATGGCTTGG -3'

Sequencing Primer
(F):5'- CAACACATTGTTAGGACTTGGTCAG -3'
(R):5'- AGATGGGGAGCTCACCTCTAAC -3'
Posted On2017-06-26