Incidental Mutation 'R6010:Nup98'
ID479709
Institutional Source Beutler Lab
Gene Symbol Nup98
Ensembl Gene ENSMUSG00000063550
Gene Namenucleoporin 98
SynonymsNup96
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102119398-102210176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102180429 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 391 (F391L)
Ref Sequence ENSEMBL: ENSMUSP00000148115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]
Predicted Effect probably damaging
Transcript: ENSMUST00000070165
AA Change: F391L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: F391L

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG 3 88 4.6e-4 PFAM
Pfam:Nucleoporin_FG 69 170 3.4e-6 PFAM
Pfam:Nucleoporin_FG 210 307 6.1e-5 PFAM
Pfam:Nucleoporin_FG 246 332 2.2e-7 PFAM
Pfam:Nucleoporin_FG 266 359 1.2e-7 PFAM
Pfam:Nucleoporin_FG 309 425 1.8e-2 PFAM
Pfam:Nucleoporin_FG 398 497 2.2e-2 PFAM
low complexity region 594 610 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
Pfam:Nucleoporin2 740 880 5.4e-45 PFAM
PDB:1KO6|D 881 925 1e-16 PDB
low complexity region 926 935 N/A INTRINSIC
low complexity region 1033 1042 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209242
Predicted Effect probably damaging
Transcript: ENSMUST00000210682
AA Change: F391L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211005
AA Change: F391L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000211022
AA Change: F391L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000211235
AA Change: F391L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect unknown
Transcript: ENSMUST00000211764
AA Change: F63L
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Nup98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Nup98 APN 7 102194987 missense probably damaging 1.00
IGL00789:Nup98 APN 7 102153971 missense probably benign
IGL00798:Nup98 APN 7 102147204 missense probably damaging 1.00
IGL01562:Nup98 APN 7 102185918 missense probably damaging 0.99
IGL01942:Nup98 APN 7 102194711 missense probably damaging 1.00
IGL02109:Nup98 APN 7 102183486 missense probably benign 0.37
IGL02490:Nup98 APN 7 102152366 missense probably damaging 1.00
IGL03184:Nup98 APN 7 102183545 missense probably damaging 0.99
PIT4519001:Nup98 UTSW 7 102134964 missense probably benign 0.00
R0040:Nup98 UTSW 7 102192034 missense probably damaging 1.00
R0133:Nup98 UTSW 7 102139652 critical splice acceptor site probably null
R0309:Nup98 UTSW 7 102152428 missense probably null
R0471:Nup98 UTSW 7 102138797 missense probably benign 0.13
R0538:Nup98 UTSW 7 102186685 missense probably damaging 1.00
R0650:Nup98 UTSW 7 102152453 missense probably damaging 1.00
R0730:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0881:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0900:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1120:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1159:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1545:Nup98 UTSW 7 102134880 missense possibly damaging 0.77
R1775:Nup98 UTSW 7 102134937 missense probably benign 0.03
R1889:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R2080:Nup98 UTSW 7 102180424 missense probably damaging 0.96
R3423:Nup98 UTSW 7 102184877 missense probably benign 0.03
R4361:Nup98 UTSW 7 102145714 missense probably damaging 1.00
R4678:Nup98 UTSW 7 102184831 missense probably damaging 1.00
R4864:Nup98 UTSW 7 102153196 missense possibly damaging 0.94
R4910:Nup98 UTSW 7 102195800 missense unknown
R4924:Nup98 UTSW 7 102134978 missense probably damaging 1.00
R5068:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5069:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5233:Nup98 UTSW 7 102195822 missense unknown
R5779:Nup98 UTSW 7 102152361 missense probably benign
R5922:Nup98 UTSW 7 102154017 missense probably damaging 1.00
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6343:Nup98 UTSW 7 102194750 missense possibly damaging 0.90
R6364:Nup98 UTSW 7 102176315 missense probably damaging 1.00
R6462:Nup98 UTSW 7 102195016 missense probably benign 0.03
R6577:Nup98 UTSW 7 102128846 splice site probably null
R6900:Nup98 UTSW 7 102185962 missense probably damaging 1.00
R7205:Nup98 UTSW 7 102195041 missense unknown
R7218:Nup98 UTSW 7 102191900 splice site probably null
R7235:Nup98 UTSW 7 102125284 missense probably damaging 1.00
R7307:Nup98 UTSW 7 102134795 missense probably benign
R7402:Nup98 UTSW 7 102134937 missense probably benign 0.00
R7427:Nup98 UTSW 7 102135001 splice site probably null
R7428:Nup98 UTSW 7 102135001 splice site probably null
R7584:Nup98 UTSW 7 102176389 missense probably benign 0.02
R7646:Nup98 UTSW 7 102154035 missense probably benign 0.01
R7648:Nup98 UTSW 7 102124197 missense possibly damaging 0.94
R7742:Nup98 UTSW 7 102153257 splice site probably null
R7827:Nup98 UTSW 7 102124362 missense probably benign 0.10
R7884:Nup98 UTSW 7 102176349 missense probably benign 0.12
R7943:Nup98 UTSW 7 102194822 missense probably benign 0.10
R8034:Nup98 UTSW 7 102145723 critical splice acceptor site probably null
T0970:Nup98 UTSW 7 102186752 unclassified probably benign
X0054:Nup98 UTSW 7 102147208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTTCCTTCTGGTATGTAGCATCAG -3'
(R):5'- TTTTGGGAATTGAACTTGAGTCCTC -3'

Sequencing Primer
(F):5'- TCAGGCTACAGCTTACCTGAG -3'
(R):5'- CTTGAGTCCTCTGAAAGAGCAGTC -3'
Posted On2017-06-26