Incidental Mutation 'R6010:Car10'
ID479718
Institutional Source Beutler Lab
Gene Symbol Car10
Ensembl Gene ENSMUSG00000056158
Gene Namecarbonic anhydrase 10
SynonymsCA-RP X, 2700029L05Rik
MMRRC Submission 044187-MU
Accession Numbers

Genbank: NM_028296; MGI: 1919855

Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location93098028-93601749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93599323 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 297 (I297V)
Ref Sequence ENSEMBL: ENSMUSP00000103495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042943] [ENSMUST00000107858] [ENSMUST00000107863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042943
AA Change: I297V

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035585
Gene: ENSMUSG00000056158
AA Change: I297V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107858
AA Change: I273V

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103490
Gene: ENSMUSG00000056158
AA Change: I273V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 277 2.21e-71 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107863
AA Change: I297V

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103495
Gene: ENSMUSG00000056158
AA Change: I297V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 33 301 2.25e-86 SMART
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Car10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Car10 APN 11 93304657 splice site probably benign
IGL01077:Car10 APN 11 93597143 missense possibly damaging 0.54
IGL01099:Car10 APN 11 93578690 missense possibly damaging 0.91
IGL02810:Car10 APN 11 93578696 missense probably damaging 1.00
IGL03037:Car10 APN 11 93100218 utr 5 prime probably benign
IGL03061:Car10 APN 11 93490525 missense probably damaging 0.98
IGL03105:Car10 APN 11 93100275 missense probably benign 0.07
IGL03347:Car10 APN 11 93100296 splice site probably benign
IGL02837:Car10 UTSW 11 93597251 missense probably damaging 0.96
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0076:Car10 UTSW 11 93490597 missense possibly damaging 0.93
R0387:Car10 UTSW 11 93583021 critical splice donor site probably null
R0511:Car10 UTSW 11 93490582 missense probably damaging 1.00
R1372:Car10 UTSW 11 93578699 missense probably benign 0.02
R4692:Car10 UTSW 11 93185158 critical splice donor site probably null
R4799:Car10 UTSW 11 93578666 missense possibly damaging 0.81
R5947:Car10 UTSW 11 93490613 missense probably damaging 1.00
R6013:Car10 UTSW 11 93185279 intron probably benign
R7268:Car10 UTSW 11 93599251 missense probably benign 0.26
R7995:Car10 UTSW 11 93597122 missense probably damaging 0.99
Z1191:Car10 UTSW 11 93304636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGGCCAGACAACAGTC -3'
(R):5'- ACCAATGCAGTCAGGGTTTTG -3'

Sequencing Primer
(F):5'- TGGCCAGACAACAGTCTACTTGG -3'
(R):5'- ATCAGGTGTGGCAGTGACTTTAC -3'
Posted On2017-06-26