Incidental Mutation 'R6010:Brms1l'
ID479722
Institutional Source Beutler Lab
Gene Symbol Brms1l
Ensembl Gene ENSMUSG00000012076
Gene Namebreast cancer metastasis-suppressor 1-like
SynonymsD12Ertd407e, BRMS1, 0710008O11Rik
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55836324-55869736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55868200 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 298 (F298S)
Ref Sequence ENSEMBL: ENSMUSP00000082500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059250] [ENSMUST00000219419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059250
AA Change: F298S

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000082500
Gene: ENSMUSG00000012076
AA Change: F298S

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Sds3 61 217 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219575
Meta Mutation Damage Score 0.2040 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shows sequence similarity to the human breast carcinoma metastasis suppressor (BRMS1) protein and the mammalian Sds3 (suppressor of defective silencing 3) proteins. This protein is a component of the mSin3a family of histone deacetylase complexes (HDAC). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Brms1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Brms1l APN 12 55845326 missense probably benign 0.15
IGL00951:Brms1l APN 12 55866049 missense possibly damaging 0.54
IGL02199:Brms1l APN 12 55861172 critical splice donor site probably benign
IGL02669:Brms1l APN 12 55841616 missense probably damaging 1.00
IGL03158:Brms1l APN 12 55836535 missense possibly damaging 0.83
IGL03184:Brms1l APN 12 55868277 makesense probably null
R0445:Brms1l UTSW 12 55861406 nonsense probably null
R0568:Brms1l UTSW 12 55861388 critical splice acceptor site probably null
R0942:Brms1l UTSW 12 55865957 missense probably benign 0.00
R0968:Brms1l UTSW 12 55866013 missense possibly damaging 0.73
R1240:Brms1l UTSW 12 55844508 missense probably damaging 1.00
R1580:Brms1l UTSW 12 55868222 missense probably damaging 1.00
R1694:Brms1l UTSW 12 55841600 missense probably damaging 1.00
R1926:Brms1l UTSW 12 55863161 missense possibly damaging 0.69
R4626:Brms1l UTSW 12 55863173 missense probably benign 0.01
R4669:Brms1l UTSW 12 55841571 missense possibly damaging 0.83
R4987:Brms1l UTSW 12 55866015 missense probably benign 0.15
R6129:Brms1l UTSW 12 55868185 missense probably benign 0.03
R7429:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7430:Brms1l UTSW 12 55845299 missense probably damaging 1.00
R7510:Brms1l UTSW 12 55845322 nonsense probably null
R7543:Brms1l UTSW 12 55868212 missense probably damaging 1.00
R7855:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
R7938:Brms1l UTSW 12 55866053 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTAGTATAAACCGGGTGGAGGC -3'
(R):5'- TAGAAGACACAGTCTCTCATGAC -3'

Sequencing Primer
(F):5'- AGGCAAGCTCAGGGCCAAC -3'
(R):5'- GACTGGATGAAATTATTAAGCTGCTG -3'
Posted On2017-06-26