Incidental Mutation 'R6010:Rbp3'
ID479725
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R6010 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33954647 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 184 (I184N)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably damaging
Transcript: ENSMUST00000035695
AA Change: I184N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: I184N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.6181 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pacsin2 A G 15: 83,381,819 V59A possibly damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
R8393:Rbp3 UTSW 14 33956199 missense possibly damaging 0.93
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ACAGAGGAACATCCGCCATG -3'
(R):5'- CCGCATCTGCTTCAGGATGTAG -3'

Sequencing Primer
(F):5'- GAACATCCGCCATGAGGTTCTTG -3'
(R):5'- ATGTAGGCAATGTCCTCTGCGAC -3'
Posted On2017-06-26