Incidental Mutation 'R6010:Pacsin2'
ID479729
Institutional Source Beutler Lab
Gene Symbol Pacsin2
Ensembl Gene ENSMUSG00000016664
Gene Nameprotein kinase C and casein kinase substrate in neurons 2
SynonymsSyndapin II
MMRRC Submission 044187-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6010 (G1)
Quality Score173.009
Status Validated
Chromosome15
Chromosomal Location83375607-83464606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83381819 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000155925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056177] [ENSMUST00000165095] [ENSMUST00000171436] [ENSMUST00000230679] [ENSMUST00000231184] [ENSMUST00000231946]
Predicted Effect probably benign
Transcript: ENSMUST00000056177
AA Change: V324A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058320
Gene: ENSMUSG00000016664
AA Change: V324A

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165095
AA Change: V324A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130098
Gene: ENSMUSG00000016664
AA Change: V324A

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171436
AA Change: V324A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131504
Gene: ENSMUSG00000016664
AA Change: V324A

DomainStartEndE-ValueType
FCH 16 104 8.73e-25 SMART
low complexity region 146 162 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
SH3 429 486 2.04e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000230030
AA Change: V150A
Predicted Effect probably benign
Transcript: ENSMUST00000230679
AA Change: V324A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231043
Predicted Effect probably benign
Transcript: ENSMUST00000231184
AA Change: V324A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231946
AA Change: V59A

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation by regulating tubulin polymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,743,870 I132M possibly damaging Het
Agap2 A T 10: 127,090,910 I939F probably damaging Het
Ahctf1 A G 1: 179,795,813 V80A possibly damaging Het
Atxn3 T C 12: 101,948,026 D67G probably damaging Het
Avl9 G A 6: 56,753,390 V573M possibly damaging Het
Baz1b G A 5: 135,217,451 E585K possibly damaging Het
Brms1l T C 12: 55,868,200 F298S possibly damaging Het
Camk2d G A 3: 126,797,714 V278I possibly damaging Het
Car10 A G 11: 93,599,323 I297V possibly damaging Het
Ccpg1os A T 9: 72,980,206 probably null Het
Cfap65 C T 1: 74,923,031 C677Y probably damaging Het
Cfap74 T A 4: 155,454,038 D872E possibly damaging Het
Cgrrf1 A C 14: 46,853,701 Q227H probably damaging Het
Chil4 A G 3: 106,214,395 I46T probably damaging Het
Chpf2 A T 5: 24,591,919 H621L probably damaging Het
Cluap1 C T 16: 3,937,573 R351W possibly damaging Het
Cnot6 A T 11: 49,683,239 Y201* probably null Het
Col15a1 T C 4: 47,245,630 V127A probably benign Het
Col6a3 C T 1: 90,773,497 V2566I unknown Het
Cope T A 8: 70,308,512 M88K probably damaging Het
Cops4 A G 5: 100,543,910 I358M possibly damaging Het
Coro7 T C 16: 4,669,956 E130G possibly damaging Het
Csrp3 A G 7: 48,835,465 probably null Het
Cyp4f39 T C 17: 32,482,186 F217L probably damaging Het
Dmac1 A G 4: 75,278,236 S6P unknown Het
Drd4 A T 7: 141,294,796 I367F probably damaging Het
Efcc1 T A 6: 87,753,729 probably null Het
Emid1 A T 11: 5,135,389 M119K possibly damaging Het
Fbn2 C T 18: 58,069,524 D1237N probably benign Het
Fbxl18 C A 5: 142,872,398 R761L probably damaging Het
Gbp10 A C 5: 105,224,339 L185R probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gucd1 G T 10: 75,420,766 probably benign Het
Helb G A 10: 120,105,883 T300M probably damaging Het
Ifna11 A T 4: 88,820,041 H28L probably benign Het
Kalrn T A 16: 34,010,580 N723I probably benign Het
Kcnb2 C T 1: 15,710,566 S554F possibly damaging Het
Med1 A C 11: 98,158,362 V536G probably damaging Het
Nanog A C 6: 122,713,296 N195T probably benign Het
Neu1 C T 17: 34,932,055 S94F probably damaging Het
Nop58 T A 1: 59,700,912 S154R probably damaging Het
Npl A T 1: 153,512,568 L239* probably null Het
Nrg1 G A 8: 31,818,572 T483M probably damaging Het
Nup98 G T 7: 102,180,429 F391L probably damaging Het
Olfr1019 T C 2: 85,841,561 I77V probably benign Het
Olfr1228 A T 2: 89,248,743 I305K probably benign Het
Olfr154 T C 2: 85,664,030 I135V probably benign Het
Olfr74 A T 2: 87,974,542 V41E probably damaging Het
Pcsk9 C T 4: 106,454,272 R254H possibly damaging Het
Psme2 C A 14: 55,587,523 probably null Het
Ptprc T A 1: 138,101,056 H468L probably benign Het
Rbp3 T A 14: 33,954,647 I184N probably damaging Het
Serpinb1c A G 13: 32,882,059 L301P probably damaging Het
Smim6 G T 11: 115,913,393 G2V probably damaging Het
Snrpb2 A G 2: 143,070,895 D146G possibly damaging Het
Svep1 T A 4: 58,115,832 S954C possibly damaging Het
Telo2 G T 17: 25,104,878 T568N possibly damaging Het
Tpp2 T C 1: 43,951,213 probably null Het
Upf1 A G 8: 70,337,025 V720A probably damaging Het
Vmn1r81 T C 7: 12,260,422 I86M possibly damaging Het
Vps8 T A 16: 21,545,205 probably benign Het
Wdr70 T C 15: 7,887,419 probably null Het
Zfp385c A T 11: 100,657,537 S30T probably benign Het
Zfp607a T A 7: 27,877,829 L108* probably null Het
Other mutations in Pacsin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Pacsin2 APN 15 83386686 missense probably damaging 1.00
IGL02574:Pacsin2 APN 15 83388663 missense possibly damaging 0.81
R0153:Pacsin2 UTSW 15 83377661 missense probably benign 0.11
R0399:Pacsin2 UTSW 15 83386782 missense probably damaging 1.00
R0426:Pacsin2 UTSW 15 83379795 missense possibly damaging 0.90
R0799:Pacsin2 UTSW 15 83379797 missense probably benign 0.44
R0842:Pacsin2 UTSW 15 83379181 missense probably damaging 0.99
R1591:Pacsin2 UTSW 15 83385051 missense probably damaging 1.00
R2406:Pacsin2 UTSW 15 83385112 unclassified probably benign
R3906:Pacsin2 UTSW 15 83379055 missense probably damaging 1.00
R4686:Pacsin2 UTSW 15 83381775 missense probably benign 0.01
R4815:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R5849:Pacsin2 UTSW 15 83390518 missense possibly damaging 0.87
R6152:Pacsin2 UTSW 15 83377699 missense probably damaging 1.00
R6367:Pacsin2 UTSW 15 83381832 missense probably benign
R6457:Pacsin2 UTSW 15 83379678 splice site probably null
R7158:Pacsin2 UTSW 15 83379742 missense possibly damaging 0.50
R7220:Pacsin2 UTSW 15 83385059 missense probably damaging 1.00
R8089:Pacsin2 UTSW 15 83379696 missense probably benign
X0027:Pacsin2 UTSW 15 83392602 missense probably benign 0.06
Z1177:Pacsin2 UTSW 15 83402001 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CGGAGTCCCTAGAATATTTGGG -3'
(R):5'- AAGAGGCAGCTTGAAGTTTGC -3'

Sequencing Primer
(F):5'- GTCCCTAGAATATTTGGGAATCATCC -3'
(R):5'- CCACAAGGCTAAGTGTTGCAATG -3'
Posted On2017-06-26