Incidental Mutation 'R6011:Fam129b'
ID479739
Institutional Source Beutler Lab
Gene Symbol Fam129b
Ensembl Gene ENSMUSG00000026796
Gene Namefamily with sequence similarity 129, member B
Synonyms9130404D14Rik
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R6011 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32876114-32925254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32922865 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 482 (Y482H)
Ref Sequence ENSEMBL: ENSMUSP00000028135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000028135] [ENSMUST00000113200]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000028135
AA Change: Y482H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028135
Gene: ENSMUSG00000026796
AA Change: Y482H

DomainStartEndE-ValueType
PH 69 194 1.81e-2 SMART
low complexity region 594 607 N/A INTRINSIC
low complexity region 685 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154514
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Fam129b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Fam129b APN 2 32912471 missense probably benign 0.04
IGL01072:Fam129b APN 2 32912415 unclassified probably benign
IGL01874:Fam129b APN 2 32905767 critical splice acceptor site probably null
IGL02302:Fam129b APN 2 32921123 missense probably benign
IGL02681:Fam129b APN 2 32911390 missense probably benign 0.05
IGL03126:Fam129b APN 2 32876386 missense possibly damaging 0.95
IGL03240:Fam129b APN 2 32922097 missense probably benign 0.00
R0125:Fam129b UTSW 2 32923821 missense probably benign 0.17
R0948:Fam129b UTSW 2 32922860 missense probably damaging 1.00
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R2130:Fam129b UTSW 2 32923647 missense probably benign 0.34
R2408:Fam129b UTSW 2 32923470 missense probably damaging 1.00
R4881:Fam129b UTSW 2 32922578 nonsense probably null
R5506:Fam129b UTSW 2 32920982 missense probably damaging 0.96
R5748:Fam129b UTSW 2 32919569 missense probably damaging 1.00
R5857:Fam129b UTSW 2 32909908 missense probably benign 0.28
R6088:Fam129b UTSW 2 32923123 missense probably damaging 1.00
R6720:Fam129b UTSW 2 32905826 missense probably damaging 1.00
R6763:Fam129b UTSW 2 32911448 critical splice donor site probably null
R6769:Fam129b UTSW 2 32895654
R7296:Fam129b UTSW 2 32922642 missense possibly damaging 0.74
R7769:Fam129b UTSW 2 32919832 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGGTGAGCCTGACTCCATTG -3'
(R):5'- TCAAAGATCAGCTCCTGGAAGC -3'

Sequencing Primer
(F):5'- AGCCTGACTCCATTGGGCTG -3'
(R):5'- TCCTGGAAGCGTGGCAG -3'
Posted On2017-06-26