Incidental Mutation 'R6011:Rpl35'
ID479740
Institutional Source Beutler Lab
Gene Symbol Rpl35
Ensembl Gene ENSMUSG00000062997
Gene Nameribosomal protein L35
Synonyms
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6011 (G1)
Quality Score219.009
Status Not validated
Chromosome2
Chromosomal Location39001580-39005624 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 39004801 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039535] [ENSMUST00000080861] [ENSMUST00000090993] [ENSMUST00000112862] [ENSMUST00000112872]
Predicted Effect probably benign
Transcript: ENSMUST00000039535
SMART Domains Protein: ENSMUSP00000043834
Gene: ENSMUSG00000035295

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 57 96 9.22e-13 SMART
WD40 99 138 4.4e-10 SMART
WD40 141 180 1.21e-7 SMART
WD40 186 224 9.97e-9 SMART
WD40 227 266 4.34e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080861
AA Change: L24Q

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079672
Gene: ENSMUSG00000062997
AA Change: L24Q

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 7 63 2.7e-22 PFAM
low complexity region 95 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090993
SMART Domains Protein: ENSMUSP00000088516
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 8 153 4.6e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112862
SMART Domains Protein: ENSMUSP00000108483
Gene: ENSMUSG00000026755

DomainStartEndE-ValueType
Pfam:P16-Arc 9 153 2.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112872
SMART Domains Protein: ENSMUSP00000108493
Gene: ENSMUSG00000035295

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 57 96 9.22e-13 SMART
WD40 99 138 4.4e-10 SMART
WD40 141 180 1.21e-7 SMART
WD40 186 224 9.97e-9 SMART
WD40 227 266 4.34e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204825
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Rpl35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2064:Rpl35 UTSW 2 39004741 missense possibly damaging 0.88
R6334:Rpl35 UTSW 2 39001742 missense possibly damaging 0.59
R7113:Rpl35 UTSW 2 39004156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCACCACAGTAGTTGGC -3'
(R):5'- CGTGAACAACGCCGAAATG -3'

Sequencing Primer
(F):5'- TCACCACAGTAGTTGGCCAAGG -3'
(R):5'- AATCGGGTGCCATCGGTC -3'
Posted On2017-06-26