Incidental Mutation 'R6011:Olfr1148'
ID479741
Institutional Source Beutler Lab
Gene Symbol Olfr1148
Ensembl Gene ENSMUSG00000061875
Gene Nameolfactory receptor 1148
SynonymsGA_x6K02T2Q125-49334566-49335510, MOR264-7
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6011 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87830533-87835803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87833915 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 292 (N292S)
Ref Sequence ENSEMBL: ENSMUSP00000149438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077580] [ENSMUST00000215230]
Predicted Effect probably damaging
Transcript: ENSMUST00000077580
AA Change: N292S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076778
Gene: ENSMUSG00000061875
AA Change: N292S

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4.1e-54 PFAM
Pfam:7tm_1 47 296 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215230
AA Change: N292S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Olfr1148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Olfr1148 APN 2 87833500 missense probably damaging 1.00
IGL01893:Olfr1148 APN 2 87833863 nonsense probably null
IGL02247:Olfr1148 APN 2 87833529 missense probably damaging 0.97
IGL02286:Olfr1148 APN 2 87833248 missense probably damaging 0.99
IGL02645:Olfr1148 APN 2 87833615 missense probably benign 0.21
R1304:Olfr1148 UTSW 2 87833705 missense possibly damaging 0.51
R1762:Olfr1148 UTSW 2 87833665 missense probably damaging 0.98
R1770:Olfr1148 UTSW 2 87833299 missense probably benign 0.05
R4308:Olfr1148 UTSW 2 87833270 missense probably damaging 0.99
R4721:Olfr1148 UTSW 2 87833171 missense probably damaging 1.00
R6225:Olfr1148 UTSW 2 87833317 missense probably benign 0.04
R6243:Olfr1148 UTSW 2 87833041 start codon destroyed probably null 0.00
R6367:Olfr1148 UTSW 2 87833593 missense probably damaging 1.00
R7379:Olfr1148 UTSW 2 87833779 missense probably damaging 1.00
R7510:Olfr1148 UTSW 2 87833528 missense probably damaging 0.97
R8003:Olfr1148 UTSW 2 87833737 missense probably benign 0.00
X0050:Olfr1148 UTSW 2 87833534 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATCCTGAGGTTGCCAACAGC -3'
(R):5'- ATCTTCCTAATAGGTCTAACCGGAAG -3'

Sequencing Primer
(F):5'- GGTTGCCAACAGCCAAAGGTC -3'
(R):5'- GGTCTAACCGGAAGATATTATTTGAG -3'
Posted On2017-06-26