Incidental Mutation 'R6011:Disp2'
ID 479743
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Name dispatched RND transporter family member 2
Synonyms B230210L08Rik, DispB
MMRRC Submission 043253-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.889) question?
Stock # R6011 (G1)
Quality Score 214.009
Status Not validated
Chromosome 2
Chromosomal Location 118610183-118625656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118621301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 678 (V678I)
Ref Sequence ENSEMBL: ENSMUSP00000037136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]
AlphaFold Q8CIP5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037547
AA Change: V678I

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: V678I

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Pfam:MMPL 435 635 9.7e-8 PFAM
Pfam:Sterol-sensing 458 611 9.1e-9 PFAM
transmembrane domain 657 679 N/A INTRINSIC
low complexity region 682 695 N/A INTRINSIC
low complexity region 748 761 N/A INTRINSIC
transmembrane domain 914 936 N/A INTRINSIC
transmembrane domain 943 965 N/A INTRINSIC
transmembrane domain 975 997 N/A INTRINSIC
transmembrane domain 1018 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110843
SMART Domains Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142072
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,136,570 (GRCm39) N533K probably benign Het
Adamts15 G T 9: 30,814,082 (GRCm39) H694Q probably damaging Het
Adcy5 T C 16: 34,977,598 (GRCm39) L377P probably benign Het
Add2 T C 6: 86,075,607 (GRCm39) L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 94,470,889 (GRCm39) probably benign Het
Ankrd13d A G 19: 4,331,962 (GRCm39) L39P probably damaging Het
Asic1 G T 15: 99,596,960 (GRCm39) A541S probably benign Het
Bhmt1b A G 18: 87,774,663 (GRCm39) E62G probably damaging Het
Bpifb2 A G 2: 153,731,496 (GRCm39) probably null Het
Catsper3 A G 13: 55,934,305 (GRCm39) I75M probably damaging Het
Ccser2 T C 14: 36,601,532 (GRCm39) E837G probably benign Het
Clasp2 C T 9: 113,705,315 (GRCm39) P557L probably benign Het
Clstn2 C T 9: 97,338,579 (GRCm39) R860Q probably benign Het
Cplx3 A T 9: 57,523,038 (GRCm39) D140E probably damaging Het
Cyp2c66 A G 19: 39,130,380 (GRCm39) K72E probably benign Het
Cyp3a44 A G 5: 145,738,084 (GRCm39) probably null Het
Dock4 T C 12: 40,867,756 (GRCm39) probably null Het
Eml3 T C 19: 8,916,471 (GRCm39) Y688H probably damaging Het
Fam187a A G 11: 102,776,267 (GRCm39) K24E probably damaging Het
Fhit T C 14: 9,870,068 (GRCm38) K134E probably benign Het
Foxl3 A G 5: 138,807,374 (GRCm39) *217W probably null Het
Gm16485 A T 9: 8,972,454 (GRCm39) probably benign Het
Gm7247 C T 14: 51,601,805 (GRCm39) S26F probably benign Het
Hmgxb3 G A 18: 61,296,096 (GRCm39) T304I probably damaging Het
Lgsn A G 1: 31,242,847 (GRCm39) S310G probably damaging Het
Muc21 T A 17: 35,933,074 (GRCm39) probably benign Het
Niban2 T C 2: 32,812,877 (GRCm39) Y482H probably damaging Het
Or12e13 A G 2: 87,664,259 (GRCm39) N292S probably damaging Het
Or4k42 C A 2: 111,320,192 (GRCm39) A104S probably benign Het
Or6c8b A T 10: 128,882,508 (GRCm39) H141Q probably benign Het
Or7g25 T A 9: 19,159,807 (GRCm39) E296V probably damaging Het
Or9i1b G A 19: 13,896,521 (GRCm39) V46I probably benign Het
Pelo A G 13: 115,226,302 (GRCm39) S52P probably benign Het
Prune2 A G 19: 17,096,080 (GRCm39) N528S probably benign Het
Rfc3 T A 5: 151,567,184 (GRCm39) I291L probably damaging Het
Rpl35 A T 2: 38,894,813 (GRCm39) probably null Het
Sectm1b C T 11: 120,946,704 (GRCm39) V64I possibly damaging Het
Serpina12 A G 12: 104,001,993 (GRCm39) M241T probably damaging Het
Serpina1a T A 12: 103,823,728 (GRCm39) D195V probably damaging Het
Sesn2 C T 4: 132,226,708 (GRCm39) V129M probably damaging Het
Slc4a1 A C 11: 102,243,357 (GRCm39) V758G probably damaging Het
Tmx4 A T 2: 134,481,756 (GRCm39) Y56N probably damaging Het
Traj50 T C 14: 54,405,091 (GRCm39) probably benign Het
Trio T G 15: 27,735,631 (GRCm39) K2820Q probably damaging Het
Ttc28 G A 5: 111,434,309 (GRCm39) G2417S probably benign Het
Usp32 T C 11: 84,922,923 (GRCm39) D665G possibly damaging Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118,616,759 (GRCm39) missense probably damaging 1.00
IGL00970:Disp2 APN 2 118,622,274 (GRCm39) missense probably damaging 1.00
IGL01790:Disp2 APN 2 118,621,361 (GRCm39) missense probably damaging 1.00
IGL01809:Disp2 APN 2 118,617,745 (GRCm39) splice site probably benign
IGL02069:Disp2 APN 2 118,621,161 (GRCm39) missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118,621,350 (GRCm39) missense probably benign
IGL02143:Disp2 APN 2 118,620,450 (GRCm39) missense probably damaging 1.00
IGL02155:Disp2 APN 2 118,622,285 (GRCm39) missense probably damaging 1.00
IGL02884:Disp2 APN 2 118,618,032 (GRCm39) splice site probably benign
IGL03113:Disp2 APN 2 118,621,259 (GRCm39) splice site probably null
IGL03194:Disp2 APN 2 118,618,110 (GRCm39) missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118,618,125 (GRCm39) missense probably benign 0.01
R0109:Disp2 UTSW 2 118,622,297 (GRCm39) missense probably damaging 1.00
R0126:Disp2 UTSW 2 118,620,819 (GRCm39) missense probably damaging 1.00
R0603:Disp2 UTSW 2 118,622,487 (GRCm39) missense probably damaging 1.00
R0610:Disp2 UTSW 2 118,622,717 (GRCm39) missense probably benign 0.02
R0639:Disp2 UTSW 2 118,621,325 (GRCm39) missense possibly damaging 0.74
R0673:Disp2 UTSW 2 118,621,325 (GRCm39) missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118,620,243 (GRCm39) missense probably benign 0.00
R0781:Disp2 UTSW 2 118,620,920 (GRCm39) missense probably damaging 1.00
R1110:Disp2 UTSW 2 118,620,920 (GRCm39) missense probably damaging 1.00
R1148:Disp2 UTSW 2 118,636,899 (GRCm39) critical splice donor site probably null
R1148:Disp2 UTSW 2 118,636,899 (GRCm39) critical splice donor site probably null
R1243:Disp2 UTSW 2 118,622,303 (GRCm39) missense probably damaging 1.00
R1587:Disp2 UTSW 2 118,622,064 (GRCm39) missense probably damaging 1.00
R1739:Disp2 UTSW 2 118,622,031 (GRCm39) missense probably damaging 1.00
R1771:Disp2 UTSW 2 118,621,778 (GRCm39) nonsense probably null
R1781:Disp2 UTSW 2 118,623,042 (GRCm39) missense probably damaging 0.96
R1918:Disp2 UTSW 2 118,622,408 (GRCm39) missense probably benign
R1956:Disp2 UTSW 2 118,622,704 (GRCm39) missense probably benign 0.02
R2167:Disp2 UTSW 2 118,622,166 (GRCm39) missense probably damaging 1.00
R2206:Disp2 UTSW 2 118,622,725 (GRCm39) missense probably benign 0.02
R4031:Disp2 UTSW 2 118,622,361 (GRCm39) missense probably benign 0.27
R4617:Disp2 UTSW 2 118,620,643 (GRCm39) missense probably benign
R4656:Disp2 UTSW 2 118,621,044 (GRCm39) missense probably damaging 1.00
R4684:Disp2 UTSW 2 118,623,237 (GRCm39) missense probably damaging 1.00
R4696:Disp2 UTSW 2 118,622,165 (GRCm39) nonsense probably null
R4697:Disp2 UTSW 2 118,622,165 (GRCm39) nonsense probably null
R4738:Disp2 UTSW 2 118,620,807 (GRCm39) missense probably damaging 0.97
R4834:Disp2 UTSW 2 118,622,985 (GRCm39) missense probably benign 0.09
R4914:Disp2 UTSW 2 118,620,935 (GRCm39) missense probably damaging 0.99
R4915:Disp2 UTSW 2 118,620,935 (GRCm39) missense probably damaging 0.99
R4918:Disp2 UTSW 2 118,620,935 (GRCm39) missense probably damaging 0.99
R5045:Disp2 UTSW 2 118,622,543 (GRCm39) missense probably benign 0.03
R5208:Disp2 UTSW 2 118,622,286 (GRCm39) missense probably damaging 1.00
R5303:Disp2 UTSW 2 118,641,329 (GRCm39) unclassified probably benign
R5350:Disp2 UTSW 2 118,618,056 (GRCm39) missense probably benign 0.23
R5355:Disp2 UTSW 2 118,617,392 (GRCm39) missense probably benign 0.00
R6031:Disp2 UTSW 2 118,620,275 (GRCm39) missense probably benign 0.01
R6031:Disp2 UTSW 2 118,620,275 (GRCm39) missense probably benign 0.01
R6139:Disp2 UTSW 2 118,621,143 (GRCm39) missense probably damaging 0.97
R6169:Disp2 UTSW 2 118,622,031 (GRCm39) missense probably damaging 1.00
R6187:Disp2 UTSW 2 118,622,624 (GRCm39) missense probably damaging 1.00
R6209:Disp2 UTSW 2 118,617,402 (GRCm39) missense probably damaging 1.00
R6250:Disp2 UTSW 2 118,621,247 (GRCm39) missense probably damaging 1.00
R6392:Disp2 UTSW 2 118,621,230 (GRCm39) missense probably damaging 1.00
R7138:Disp2 UTSW 2 118,617,361 (GRCm39) missense probably benign
R7156:Disp2 UTSW 2 118,622,292 (GRCm39) missense probably damaging 1.00
R7230:Disp2 UTSW 2 118,622,286 (GRCm39) missense probably damaging 1.00
R7400:Disp2 UTSW 2 118,622,367 (GRCm39) missense probably damaging 1.00
R7460:Disp2 UTSW 2 118,620,261 (GRCm39) missense probably damaging 1.00
R7505:Disp2 UTSW 2 118,621,569 (GRCm39) missense probably damaging 1.00
R7542:Disp2 UTSW 2 118,621,599 (GRCm39) missense probably damaging 0.97
R7728:Disp2 UTSW 2 118,621,961 (GRCm39) missense probably benign 0.31
R7757:Disp2 UTSW 2 118,621,391 (GRCm39) missense probably damaging 1.00
R7798:Disp2 UTSW 2 118,622,360 (GRCm39) missense probably benign
R7945:Disp2 UTSW 2 118,623,270 (GRCm39) missense probably damaging 1.00
R8013:Disp2 UTSW 2 118,620,163 (GRCm39) nonsense probably null
R8085:Disp2 UTSW 2 118,617,452 (GRCm39) missense possibly damaging 0.94
R8179:Disp2 UTSW 2 118,623,030 (GRCm39) missense probably damaging 0.99
R8288:Disp2 UTSW 2 118,620,762 (GRCm39) missense probably damaging 1.00
R8345:Disp2 UTSW 2 118,641,284 (GRCm39) missense unknown
R8385:Disp2 UTSW 2 118,620,891 (GRCm39) missense probably damaging 1.00
R8700:Disp2 UTSW 2 118,620,340 (GRCm39) nonsense probably null
R8808:Disp2 UTSW 2 118,620,489 (GRCm39) missense probably damaging 1.00
R8880:Disp2 UTSW 2 118,621,239 (GRCm39) missense probably damaging 1.00
R8997:Disp2 UTSW 2 118,617,467 (GRCm39) missense probably damaging 1.00
R9022:Disp2 UTSW 2 118,621,179 (GRCm39) missense probably benign 0.22
R9181:Disp2 UTSW 2 118,617,393 (GRCm39) missense probably benign 0.08
R9660:Disp2 UTSW 2 118,620,627 (GRCm39) missense probably benign
Z1177:Disp2 UTSW 2 118,621,308 (GRCm39) missense probably damaging 1.00
Z1177:Disp2 UTSW 2 118,620,183 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAGCGCTACTTGGCTCAC -3'
(R):5'- CACTTACCACTGAGCTGTTGG -3'

Sequencing Primer
(F):5'- CTACTTGGCTCACGGCTG -3'
(R):5'- ACTAGTGTCCACTGGCAGGATTC -3'
Posted On 2017-06-26