Mutagenetix > Incidental Mutations

Incidental Mutation 'R6011:Disp2'

479743

Institutional Source

Beutler Lab

Gene Symbol

Disp2

Ensembl Gene

ENSMUSG00000040035

Gene Name

dispatched RND tramsporter family member 2

Synonyms

B230210L08Rik, DispB

MMRRC Submission

043253-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.826) question?

Stock #

R6011 (G1)

Quality Score

214.009

Status

Not validated

Chromosome

Chromosomal Location

118779719-118811293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118790820 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 678 (V678I)

Ref Sequence

ENSEMBL: ENSMUSP00000037136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037547
AA Change: V678I

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: V678I

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC
Pfam:MMPL	435	635	9.7e-8	PFAM
Pfam:Sterol-sensing	458	611	9.1e-9	PFAM
transmembrane domain	657	679	N/A	INTRINSIC
low complexity region	682	695	N/A	INTRINSIC
low complexity region	748	761	N/A	INTRINSIC
transmembrane domain	914	936	N/A	INTRINSIC
transmembrane domain	943	965	N/A	INTRINSIC
transmembrane domain	975	997	N/A	INTRINSIC
transmembrane domain	1018	1040	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063975

SMART Domains

Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110843

SMART Domains

Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110846

SMART Domains

Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142072

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,245,744	N533K	probably benign	Het
Adamts15	G	T	9: 30,902,786	H694Q	probably damaging	Het
Adcy5	T	C	16: 35,157,228	L377P	probably benign	Het
Add2	T	C	6: 86,098,625	L252P	probably damaging	Het
Amer1	ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	X: 95,427,283		probably benign	Het
Ankrd13d	A	G	19: 4,281,934	L39P	probably damaging	Het
Asic1	G	T	15: 99,699,079	A541S	probably benign	Het
Bpifb2	A	G	2: 153,889,576		probably null	Het
Catsper3	A	G	13: 55,786,492	I75M	probably damaging	Het
Ccser2	T	C	14: 36,879,575	E837G	probably benign	Het
Clasp2	C	T	9: 113,876,247	P557L	probably benign	Het
Clstn2	C	T	9: 97,456,526	R860Q	probably benign	Het
Cyp2c66	A	G	19: 39,141,936	K72E	probably benign	Het
Cyp3a44	A	G	5: 145,801,274		probably null	Het
Dock4	T	C	12: 40,817,757		probably null	Het
Eml3	T	C	19: 8,939,107	Y688H	probably damaging	Het
Fam129b	T	C	2: 32,922,865	Y482H	probably damaging	Het
Fam187a	A	G	11: 102,885,441	K24E	probably damaging	Het
Fhit	T	C	14: 9,870,068	K134E	probably benign	Het
Gm16485	A	T	9: 8,972,453		probably benign	Het
Gm5096	A	G	18: 87,756,539	E62G	probably damaging	Het
Gm5294	A	G	5: 138,821,619	*217W	probably null	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Gm9573	T	A	17: 35,622,182		probably benign	Het
Hmgxb3	G	A	18: 61,163,024	T304I	probably damaging	Het
Lgsn	A	G	1: 31,203,766	S310G	probably damaging	Het
Lman1l	A	T	9: 57,615,755	D140E	probably damaging	Het
Olfr1148	A	G	2: 87,833,915	N292S	probably damaging	Het
Olfr1290	C	A	2: 111,489,847	A104S	probably benign	Het
Olfr1505	G	A	19: 13,919,157	V46I	probably benign	Het
Olfr765	A	T	10: 129,046,639	H141Q	probably benign	Het
Olfr843	T	A	9: 19,248,511	E296V	probably damaging	Het
Pelo	A	G	13: 115,089,766	S52P	probably benign	Het
Prune2	A	G	19: 17,118,716	N528S	probably benign	Het
Rfc3	T	A	5: 151,643,719	I291L	probably damaging	Het
Rpl35	A	T	2: 39,004,801		probably null	Het
Sectm1b	C	T	11: 121,055,878	V64I	possibly damaging	Het
Serpina12	A	G	12: 104,035,734	M241T	probably damaging	Het
Serpina1a	T	A	12: 103,857,469	D195V	probably damaging	Het
Sesn2	C	T	4: 132,499,397	V129M	probably damaging	Het
Slc4a1	A	C	11: 102,352,531	V758G	probably damaging	Het
Tmx4	A	T	2: 134,639,836	Y56N	probably damaging	Het
Traj50	T	C	14: 54,167,634		probably benign	Het
Trio	T	G	15: 27,735,545	K2820Q	probably damaging	Het
Ttc28	G	A	5: 111,286,443	G2417S	probably benign	Het
Usp32	T	C	11: 85,032,097	D665G	possibly damaging	Het

Other mutations in Disp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Disp2	APN	2	118786278	missense	probably damaging	1.00
IGL00970:Disp2	APN	2	118791793	missense	probably damaging	1.00
IGL01790:Disp2	APN	2	118790880	missense	probably damaging	1.00
IGL01809:Disp2	APN	2	118787264	splice site	probably benign
IGL02069:Disp2	APN	2	118790680	missense	possibly damaging	0.93
IGL02140:Disp2	APN	2	118790869	missense	probably benign
IGL02143:Disp2	APN	2	118789969	missense	probably damaging	1.00
IGL02155:Disp2	APN	2	118791804	missense	probably damaging	1.00
IGL02884:Disp2	APN	2	118787551	splice site	probably benign
IGL03113:Disp2	APN	2	118790778	unclassified	probably null
IGL03194:Disp2	APN	2	118787629	missense	probably damaging	1.00
PIT4453001:Disp2	UTSW	2	118787644	missense	probably benign	0.01
R0109:Disp2	UTSW	2	118791816	missense	probably damaging	1.00
R0126:Disp2	UTSW	2	118790338	missense	probably damaging	1.00
R0603:Disp2	UTSW	2	118792006	missense	probably damaging	1.00
R0610:Disp2	UTSW	2	118792236	missense	probably benign	0.02
R0639:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0673:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0755:Disp2	UTSW	2	118789762	missense	probably benign	0.00
R0781:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1110:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1243:Disp2	UTSW	2	118791822	missense	probably damaging	1.00
R1587:Disp2	UTSW	2	118791583	missense	probably damaging	1.00
R1739:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R1771:Disp2	UTSW	2	118791297	nonsense	probably null
R1781:Disp2	UTSW	2	118792561	missense	probably damaging	0.96
R1918:Disp2	UTSW	2	118791927	missense	probably benign
R1956:Disp2	UTSW	2	118792223	missense	probably benign	0.02
R2167:Disp2	UTSW	2	118791685	missense	probably damaging	1.00
R2206:Disp2	UTSW	2	118792244	missense	probably benign	0.02
R4031:Disp2	UTSW	2	118791880	missense	probably benign	0.27
R4617:Disp2	UTSW	2	118790162	missense	probably benign
R4656:Disp2	UTSW	2	118790563	missense	probably damaging	1.00
R4684:Disp2	UTSW	2	118792756	missense	probably damaging	1.00
R4696:Disp2	UTSW	2	118791684	nonsense	probably null
R4697:Disp2	UTSW	2	118791684	nonsense	probably null
R4738:Disp2	UTSW	2	118790326	missense	probably damaging	0.97
R4834:Disp2	UTSW	2	118792504	missense	probably benign	0.09
R4914:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R4915:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R4918:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R5045:Disp2	UTSW	2	118792062	missense	probably benign	0.03
R5208:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R5303:Disp2	UTSW	2	118810848	unclassified	probably benign
R5350:Disp2	UTSW	2	118787575	missense	probably benign	0.23
R5355:Disp2	UTSW	2	118786911	missense	probably benign	0.00
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6139:Disp2	UTSW	2	118790662	missense	probably damaging	0.97
R6169:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R6187:Disp2	UTSW	2	118792143	missense	probably damaging	1.00
R6209:Disp2	UTSW	2	118786921	missense	probably damaging	1.00
R6250:Disp2	UTSW	2	118790766	missense	probably damaging	1.00
R6392:Disp2	UTSW	2	118790749	missense	probably damaging	1.00
R7138:Disp2	UTSW	2	118786880	missense	probably benign
R7156:Disp2	UTSW	2	118791811	missense	probably damaging	1.00
R7230:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R7400:Disp2	UTSW	2	118791886	missense	probably damaging	1.00
R7460:Disp2	UTSW	2	118789780	missense	probably damaging	1.00
R7505:Disp2	UTSW	2	118791088	missense	probably damaging	1.00
R7542:Disp2	UTSW	2	118791118	missense	probably damaging	0.97
R7728:Disp2	UTSW	2	118791480	missense	probably benign	0.31
R7757:Disp2	UTSW	2	118790910	missense	probably damaging	1.00
R7798:Disp2	UTSW	2	118791879	missense	probably benign
R8013:Disp2	UTSW	2	118789682	nonsense	probably null
Z1177:Disp2	UTSW	2	118789702	missense	probably damaging	0.99
Z1177:Disp2	UTSW	2	118790827	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAGCGCTACTTGGCTCAC -3'
(R):5'- CACTTACCACTGAGCTGTTGG -3'

Sequencing Primer
(F):5'- CTACTTGGCTCACGGCTG -3'
(R):5'- ACTAGTGTCCACTGGCAGGATTC -3'

Posted On

2017-06-26