Incidental Mutation 'R6011:Lman1l'
ID 479755
Institutional Source Beutler Lab
Gene Symbol Lman1l
Ensembl Gene ENSMUSG00000056271
Gene Name lectin, mannose-binding 1 like
Synonyms
MMRRC Submission 043253-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6011 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 57607085-57620774 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57615755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 140 (D140E)
Ref Sequence ENSEMBL: ENSMUSP00000091352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044937] [ENSMUST00000093832]
AlphaFold Q8VCD3
Predicted Effect probably damaging
Transcript: ENSMUST00000044937
AA Change: D140E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041631
Gene: ENSMUSG00000056271
AA Change: D140E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 1.2e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093832
AA Change: D140E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271
AA Change: D140E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Lectin_leg-like 32 256 2.7e-53 PFAM
low complexity region 272 287 N/A INTRINSIC
coiled coil region 316 337 N/A INTRINSIC
transmembrane domain 439 461 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannose-binding type 1 transmembrane protein that contains an N-terminal lectin-like carbohydrate recognition domain. The encoded protein is similar in structure to lectins found in leguminous plants. This lectin is thought to transport newly synthesized glycoproteins from the endoplasmic reticulum (ER) to the ER-Golgi intermediate compartment. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Lman1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Lman1l APN 9 57620564 missense probably damaging 1.00
IGL03164:Lman1l APN 9 57609995 missense probably damaging 0.99
IGL03226:Lman1l APN 9 57610007 missense probably benign 0.43
PIT4283001:Lman1l UTSW 9 57616076 missense probably damaging 1.00
R0555:Lman1l UTSW 9 57614101 missense probably benign 0.15
R1168:Lman1l UTSW 9 57608312 missense probably benign 0.00
R1169:Lman1l UTSW 9 57609995 missense probably damaging 0.99
R1591:Lman1l UTSW 9 57615802 missense probably benign 0.30
R2289:Lman1l UTSW 9 57613658 missense possibly damaging 0.76
R3848:Lman1l UTSW 9 57608317 missense possibly damaging 0.48
R4685:Lman1l UTSW 9 57609200 missense probably damaging 0.98
R5170:Lman1l UTSW 9 57615619 nonsense probably null
R5309:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5312:Lman1l UTSW 9 57611077 missense probably damaging 0.98
R5639:Lman1l UTSW 9 57611866 missense probably benign 0.24
R5655:Lman1l UTSW 9 57615975 missense probably damaging 1.00
R5905:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6028:Lman1l UTSW 9 57608263 missense probably damaging 1.00
R6035:Lman1l UTSW 9 57611747 critical splice donor site probably null
R6035:Lman1l UTSW 9 57611747 critical splice donor site probably null
R6250:Lman1l UTSW 9 57615624 missense probably benign 0.00
R6488:Lman1l UTSW 9 57620643 missense possibly damaging 0.73
R6489:Lman1l UTSW 9 57613726 splice site probably null
R6720:Lman1l UTSW 9 57614072 splice site probably null
R7000:Lman1l UTSW 9 57615948 missense probably benign 0.27
R7139:Lman1l UTSW 9 57615596 missense probably benign 0.37
R8822:Lman1l UTSW 9 57607188 missense probably benign 0.00
R9800:Lman1l UTSW 9 57615777 missense probably damaging 0.99
X0057:Lman1l UTSW 9 57615957 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGTGGTTGATAAGCCCAAG -3'
(R):5'- TCATATCTGTTGGGGAAGCAGG -3'

Sequencing Primer
(F):5'- GGGGTGCTCAGTTCTCTCAC -3'
(R):5'- CAGGTGATAGGACACAGGTACC -3'
Posted On 2017-06-26