Mutagenetix > Incidental Mutation

Incidental Mutation 'R6011:Usp32'

479760

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

043253-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6011 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85032097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 665 (D665G)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075] [ENSMUST00000172515]

AlphaFold

F8VPZ3

Predicted Effect

probably benign
Transcript: ENSMUST00000000821

SMART Domains

Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Pfam:UCH	32	260	4.1e-51	PFAM
Pfam:UCH_1	33	228	1.7e-7	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108075
AA Change: D665G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: D665G

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172515

SMART Domains

Protein: ENSMUSP00000133781
Gene: ENSMUSG00000000804

Domain	Start	End	E-Value	Type
Blast:DUSP	1	52	7e-30	BLAST
low complexity region	53	65	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000174602
AA Change: D169G

SMART Domains

Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804
AA Change: D169G

Domain	Start	End	E-Value	Type
Pfam:DUSP	1	65	6.5e-17	PFAM
Pfam:Ubiquitin_3	122	216	8e-10	PFAM
Pfam:UCH	238	257	1.2e-7	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	A	11: 84,245,744	N533K	probably benign	Het
Adamts15	G	T	9: 30,902,786	H694Q	probably damaging	Het
Adcy5	T	C	16: 35,157,228	L377P	probably benign	Het
Add2	T	C	6: 86,098,625	L252P	probably damaging	Het
Amer1	ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC	X: 95,427,283		probably benign	Het
Ankrd13d	A	G	19: 4,281,934	L39P	probably damaging	Het
Asic1	G	T	15: 99,699,079	A541S	probably benign	Het
Bpifb2	A	G	2: 153,889,576		probably null	Het
Catsper3	A	G	13: 55,786,492	I75M	probably damaging	Het
Ccser2	T	C	14: 36,879,575	E837G	probably benign	Het
Clasp2	C	T	9: 113,876,247	P557L	probably benign	Het
Clstn2	C	T	9: 97,456,526	R860Q	probably benign	Het
Cyp2c66	A	G	19: 39,141,936	K72E	probably benign	Het
Cyp3a44	A	G	5: 145,801,274		probably null	Het
Disp2	G	A	2: 118,790,820	V678I	possibly damaging	Het
Dock4	T	C	12: 40,817,757		probably null	Het
Eml3	T	C	19: 8,939,107	Y688H	probably damaging	Het
Fam129b	T	C	2: 32,922,865	Y482H	probably damaging	Het
Fam187a	A	G	11: 102,885,441	K24E	probably damaging	Het
Fhit	T	C	14: 9,870,068	K134E	probably benign	Het
Gm16485	A	T	9: 8,972,453		probably benign	Het
Gm5096	A	G	18: 87,756,539	E62G	probably damaging	Het
Gm5294	A	G	5: 138,821,619	*217W	probably null	Het
Gm7247	C	T	14: 51,364,348	S26F	probably benign	Het
Gm9573	T	A	17: 35,622,182		probably benign	Het
Hmgxb3	G	A	18: 61,163,024	T304I	probably damaging	Het
Lgsn	A	G	1: 31,203,766	S310G	probably damaging	Het
Lman1l	A	T	9: 57,615,755	D140E	probably damaging	Het
Olfr1148	A	G	2: 87,833,915	N292S	probably damaging	Het
Olfr1290	C	A	2: 111,489,847	A104S	probably benign	Het
Olfr1505	G	A	19: 13,919,157	V46I	probably benign	Het
Olfr765	A	T	10: 129,046,639	H141Q	probably benign	Het
Olfr843	T	A	9: 19,248,511	E296V	probably damaging	Het
Pelo	A	G	13: 115,089,766	S52P	probably benign	Het
Prune2	A	G	19: 17,118,716	N528S	probably benign	Het
Rfc3	T	A	5: 151,643,719	I291L	probably damaging	Het
Rpl35	A	T	2: 39,004,801		probably null	Het
Sectm1b	C	T	11: 121,055,878	V64I	possibly damaging	Het
Serpina12	A	G	12: 104,035,734	M241T	probably damaging	Het
Serpina1a	T	A	12: 103,857,469	D195V	probably damaging	Het
Sesn2	C	T	4: 132,499,397	V129M	probably damaging	Het
Slc4a1	A	C	11: 102,352,531	V758G	probably damaging	Het
Tmx4	A	T	2: 134,639,836	Y56N	probably damaging	Het
Traj50	T	C	14: 54,167,634		probably benign	Het
Trio	T	G	15: 27,735,545	K2820Q	probably damaging	Het
Ttc28	G	A	5: 111,286,443	G2417S	probably benign	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4396:Usp32	UTSW	11	85053975	missense	probably benign
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
R8924:Usp32	UTSW	11	85025544	missense	probably damaging	0.98
R9002:Usp32	UTSW	11	85053951	missense	probably damaging	0.96
R9145:Usp32	UTSW	11	85022292	missense	probably damaging	1.00
R9209:Usp32	UTSW	11	85040012	missense	probably damaging	0.98
R9211:Usp32	UTSW	11	85022733	missense	probably damaging	1.00
R9296:Usp32	UTSW	11	85017652	missense	probably damaging	1.00
R9310:Usp32	UTSW	11	85051202	missense	probably benign	0.29
R9417:Usp32	UTSW	11	84994543	missense	probably damaging	1.00
R9514:Usp32	UTSW	11	85022734	missense	probably damaging	0.99
R9652:Usp32	UTSW	11	85030491	missense	probably damaging	0.97
R9723:Usp32	UTSW	11	85044710	nonsense	probably null
R9757:Usp32	UTSW	11	85077329	nonsense	probably null
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACCCCAGACATGGCATTTAGC -3'
(R):5'- TACTACAGTCGCTGTTGCTG -3'

Sequencing Primer
(F):5'- CCCAGACATGGCATTTAGCATAAC -3'
(R):5'- CGCTGTTGCTGAGGCCAATG -3'

Posted On

2017-06-26