Incidental Mutation 'R6011:Sectm1b'
ID479763
Institutional Source Beutler Lab
Gene Symbol Sectm1b
Ensembl Gene ENSMUSG00000039364
Gene Namesecreted and transmembrane 1B
SynonymsK12, Sectm1, 1810003C24Rik
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6011 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location121053458-121063569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121055878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 64 (V64I)
Ref Sequence ENSEMBL: ENSMUSP00000126486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039309] [ENSMUST00000081499] [ENSMUST00000130786] [ENSMUST00000168459] [ENSMUST00000170381]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039309
AA Change: V64I

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045748
Gene: ENSMUSG00000039364
AA Change: V64I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 40 134 1.81e-1 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081499
AA Change: V64I

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080217
Gene: ENSMUSG00000039364
AA Change: V64I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 40 134 1.81e-1 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130786
AA Change: V64I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116010
Gene: ENSMUSG00000039364
AA Change: V64I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 40 134 1.81e-1 SMART
transmembrane domain 160 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150577
Predicted Effect possibly damaging
Transcript: ENSMUST00000168459
AA Change: V64I

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125965
Gene: ENSMUSG00000039364
AA Change: V64I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 40 134 1.81e-1 SMART
transmembrane domain 161 183 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170381
AA Change: V64I

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126486
Gene: ENSMUSG00000039364
AA Change: V64I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 40 134 1.81e-1 SMART
transmembrane domain 161 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Sectm1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Sectm1b APN 11 121055973 missense probably benign 0.02
IGL00898:Sectm1b APN 11 121056249 missense probably damaging 1.00
IGL02071:Sectm1b APN 11 121055935 missense probably damaging 0.96
R0243:Sectm1b UTSW 11 121055785 missense probably damaging 1.00
R1483:Sectm1b UTSW 11 121055826 missense probably benign 0.14
R1862:Sectm1b UTSW 11 121054942 missense possibly damaging 0.92
R4647:Sectm1b UTSW 11 121055934 missense probably damaging 1.00
R5927:Sectm1b UTSW 11 121055674 missense probably benign
R7749:Sectm1b UTSW 11 121054942 missense possibly damaging 0.92
RF018:Sectm1b UTSW 11 121054930 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGAACTCTGCCTGGAATCCAC -3'
(R):5'- TTGAACCAACTCTGAGAGTAGCTG -3'

Sequencing Primer
(F):5'- TGGAATCCACGCAGCTTC -3'
(R):5'- CCAACTCTGAGAGTAGCTGATGATG -3'
Posted On2017-06-26