Incidental Mutation 'R6011:Catsper3'
ID479767
Institutional Source Beutler Lab
Gene Symbol Catsper3
Ensembl Gene ENSMUSG00000021499
Gene Namecation channel, sperm associated 3
Synonyms
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6011 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55784568-55808998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55786492 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 75 (I75M)
Ref Sequence ENSEMBL: ENSMUSP00000105524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021961] [ENSMUST00000109898]
Predicted Effect probably damaging
Transcript: ENSMUST00000021961
AA Change: I75M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021961
Gene: ENSMUSG00000021499
AA Change: I75M

DomainStartEndE-ValueType
Pfam:Ion_trans 49 277 1.8e-33 PFAM
Pfam:PKD_channel 144 273 5e-7 PFAM
coiled coil region 283 311 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109898
AA Change: I75M

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105524
Gene: ENSMUSG00000021499
AA Change: I75M

DomainStartEndE-ValueType
Pfam:Ion_trans 72 254 4.9e-32 PFAM
Pfam:PKD_channel 125 261 2.1e-7 PFAM
coiled coil region 270 298 N/A INTRINSIC
low complexity region 374 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154384
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for this mutation are viable and exhibit no gross physical or behavioral abnormality. Although wild-type and homozygous mutant females bred to wild-type males exhibit similar fertility, male homozygotes are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Ankrd13d A G 19: 4,281,934 L39P probably damaging Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Catsper3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Catsper3 APN 13 55798822 missense possibly damaging 0.94
IGL01794:Catsper3 APN 13 55798906 missense possibly damaging 0.84
IGL02419:Catsper3 APN 13 55808068 missense possibly damaging 0.94
IGL03108:Catsper3 APN 13 55808035 missense probably benign 0.01
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R1870:Catsper3 UTSW 13 55805748 missense probably damaging 1.00
R2229:Catsper3 UTSW 13 55808054 missense probably damaging 1.00
R3055:Catsper3 UTSW 13 55808896 missense unknown
R3056:Catsper3 UTSW 13 55808896 missense unknown
R4092:Catsper3 UTSW 13 55784671 missense probably benign 0.00
R4113:Catsper3 UTSW 13 55786370 missense probably damaging 0.99
R5197:Catsper3 UTSW 13 55808176 critical splice donor site probably null
R6064:Catsper3 UTSW 13 55806252 missense probably damaging 0.99
R6385:Catsper3 UTSW 13 55786426 missense probably damaging 0.99
R6966:Catsper3 UTSW 13 55798859 missense probably damaging 0.98
R7128:Catsper3 UTSW 13 55798849 missense probably benign 0.00
R7373:Catsper3 UTSW 13 55808132 missense possibly damaging 0.87
R7565:Catsper3 UTSW 13 55784725 missense probably benign 0.10
Z1088:Catsper3 UTSW 13 55808104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTCTCTGTGTAACCACGC -3'
(R):5'- AAGAGAGAATTCTGGGAGGTTTACC -3'

Sequencing Primer
(F):5'- GTGTAACCACGCCTCTCG -3'
(R):5'- GCCACTAACTGATGCTACTGTGG -3'
Posted On2017-06-26