Incidental Mutation 'R6011:Ankrd13d'
ID479779
Institutional Source Beutler Lab
Gene Symbol Ankrd13d
Ensembl Gene ENSMUSG00000005986
Gene Nameankyrin repeat domain 13 family, member D
Synonyms
MMRRC Submission 043253-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6011 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4270180-4283137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4281934 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000130995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000056888] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000163858] [ENSMUST00000167215] [ENSMUST00000169192] [ENSMUST00000171123]
Predicted Effect probably benign
Transcript: ENSMUST00000025791
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056888
AA Change: L112P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053783
Gene: ENSMUSG00000005986
AA Change: L112P

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Pfam:GPCR_chapero_1 155 469 1.2e-111 PFAM
UIM 482 501 3.2e-2 SMART
UIM 528 547 1.92e2 SMART
UIM 564 583 8.18e0 SMART
UIM 589 605 6e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088737
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113837
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163858
SMART Domains Protein: ENSMUSP00000128932
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167215
AA Change: L112P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128037
Gene: ENSMUSG00000005986
AA Change: L112P

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169192
AA Change: L39P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130995
Gene: ENSMUSG00000005986
AA Change: L39P

DomainStartEndE-ValueType
Blast:ANK 1 28 5e-11 BLAST
Pfam:GPCR_chapero_1 82 121 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169653
Predicted Effect probably benign
Transcript: ENSMUST00000170283
SMART Domains Protein: ENSMUSP00000126349
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 98 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171123
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat domain (ANKRD) 13 family, which currently consists of four proteins containing ubiquitin-interacting motifs. These proteins are integral membrane proteins that bind specifically to Lys-63-linked ubiquitin chains on membrane-bound proteins, targeting those proteins for rapid internalization. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,245,744 N533K probably benign Het
Adamts15 G T 9: 30,902,786 H694Q probably damaging Het
Adcy5 T C 16: 35,157,228 L377P probably benign Het
Add2 T C 6: 86,098,625 L252P probably damaging Het
Amer1 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 95,427,283 probably benign Het
Asic1 G T 15: 99,699,079 A541S probably benign Het
Bpifb2 A G 2: 153,889,576 probably null Het
Catsper3 A G 13: 55,786,492 I75M probably damaging Het
Ccser2 T C 14: 36,879,575 E837G probably benign Het
Clasp2 C T 9: 113,876,247 P557L probably benign Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Cyp2c66 A G 19: 39,141,936 K72E probably benign Het
Cyp3a44 A G 5: 145,801,274 probably null Het
Disp2 G A 2: 118,790,820 V678I possibly damaging Het
Dock4 T C 12: 40,817,757 probably null Het
Eml3 T C 19: 8,939,107 Y688H probably damaging Het
Fam129b T C 2: 32,922,865 Y482H probably damaging Het
Fam187a A G 11: 102,885,441 K24E probably damaging Het
Fhit T C 14: 9,870,068 K134E probably benign Het
Gm16485 A T 9: 8,972,453 probably benign Het
Gm5096 A G 18: 87,756,539 E62G probably damaging Het
Gm5294 A G 5: 138,821,619 *217W probably null Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm9573 T A 17: 35,622,182 probably benign Het
Hmgxb3 G A 18: 61,163,024 T304I probably damaging Het
Lgsn A G 1: 31,203,766 S310G probably damaging Het
Lman1l A T 9: 57,615,755 D140E probably damaging Het
Olfr1148 A G 2: 87,833,915 N292S probably damaging Het
Olfr1290 C A 2: 111,489,847 A104S probably benign Het
Olfr1505 G A 19: 13,919,157 V46I probably benign Het
Olfr765 A T 10: 129,046,639 H141Q probably benign Het
Olfr843 T A 9: 19,248,511 E296V probably damaging Het
Pelo A G 13: 115,089,766 S52P probably benign Het
Prune2 A G 19: 17,118,716 N528S probably benign Het
Rfc3 T A 5: 151,643,719 I291L probably damaging Het
Rpl35 A T 2: 39,004,801 probably null Het
Sectm1b C T 11: 121,055,878 V64I possibly damaging Het
Serpina12 A G 12: 104,035,734 M241T probably damaging Het
Serpina1a T A 12: 103,857,469 D195V probably damaging Het
Sesn2 C T 4: 132,499,397 V129M probably damaging Het
Slc4a1 A C 11: 102,352,531 V758G probably damaging Het
Tmx4 A T 2: 134,639,836 Y56N probably damaging Het
Traj50 T C 14: 54,167,634 probably benign Het
Trio T G 15: 27,735,545 K2820Q probably damaging Het
Ttc28 G A 5: 111,286,443 G2417S probably benign Het
Usp32 T C 11: 85,032,097 D665G possibly damaging Het
Other mutations in Ankrd13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Ankrd13d APN 19 4273564 missense probably benign 0.21
IGL02480:Ankrd13d APN 19 4271463 missense possibly damaging 0.67
R0639:Ankrd13d UTSW 19 4273019 critical splice donor site probably null
R0673:Ankrd13d UTSW 19 4273019 critical splice donor site probably null
R1423:Ankrd13d UTSW 19 4281069 missense probably damaging 1.00
R1592:Ankrd13d UTSW 19 4282891 missense probably benign 0.21
R1682:Ankrd13d UTSW 19 4282933 missense probably damaging 1.00
R1843:Ankrd13d UTSW 19 4271595 missense probably damaging 0.99
R2277:Ankrd13d UTSW 19 4280984 missense probably benign 0.03
R2376:Ankrd13d UTSW 19 4272595 missense possibly damaging 0.79
R2483:Ankrd13d UTSW 19 4281940 missense probably damaging 0.96
R3623:Ankrd13d UTSW 19 4281940 missense probably damaging 0.96
R4066:Ankrd13d UTSW 19 4270360 missense probably benign 0.00
R5871:Ankrd13d UTSW 19 4281994 missense possibly damaging 0.92
R6057:Ankrd13d UTSW 19 4282228 missense probably damaging 0.97
R6167:Ankrd13d UTSW 19 4273053 missense probably damaging 1.00
R7747:Ankrd13d UTSW 19 4280985 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACCCAGTCTCATCTGCATG -3'
(R):5'- GAGACTAGCTTCCAGGTTGGTG -3'

Sequencing Primer
(F):5'- ATGGGCCTGGGATCCCATATTTC -3'
(R):5'- ACTAGCTTCCAGGTTGGTGAATGG -3'
Posted On2017-06-26