Incidental Mutation 'R6012:Stard9'
ID 479790
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene Name StAR related lipid transfer domain containing 9
Synonyms 4831403C07Rik, E230025N21Rik, Kif16a, N-3 kinesin
MMRRC Submission 044188-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R6012 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120459602-120562376 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120535067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 3775 (S3775P)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: S3775P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: S3775P

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Meta Mutation Damage Score 0.2605 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,400,691 (GRCm39) Y97N probably damaging Het
Adrm1b C A 3: 92,336,791 (GRCm39) probably null Het
Akr1b10 A T 6: 34,364,715 (GRCm39) I59F probably damaging Het
Als2 A T 1: 59,224,374 (GRCm39) D1076E probably damaging Het
Bank1 T C 3: 135,919,598 (GRCm39) D266G probably benign Het
Bmp2k T A 5: 97,211,467 (GRCm39) probably null Het
Cdc42bpa A G 1: 179,892,655 (GRCm39) Y273C probably damaging Het
Chfr G T 5: 110,292,517 (GRCm39) probably null Het
Dapk1 A T 13: 60,909,476 (GRCm39) Q1363L probably benign Het
Ddx23 A T 15: 98,548,651 (GRCm39) D352E possibly damaging Het
Ect2 T C 3: 27,152,474 (GRCm39) probably benign Het
Efcab10 A C 12: 33,448,592 (GRCm39) D107A probably damaging Het
Fcgr4 G A 1: 170,853,233 (GRCm39) G146D possibly damaging Het
Fgd5 A G 6: 91,966,322 (GRCm39) T694A possibly damaging Het
Ghr T C 15: 3,370,409 (GRCm39) D152G probably damaging Het
Gli2 A C 1: 118,765,445 (GRCm39) L902R probably damaging Het
Glis2 G A 16: 4,429,172 (GRCm39) G125D possibly damaging Het
Gmcl1 A G 6: 86,698,394 (GRCm39) Y168H probably damaging Het
Golga4 A G 9: 118,388,764 (GRCm39) K1962R possibly damaging Het
Hebp1 T A 6: 135,145,055 (GRCm39) E14V probably damaging Het
Hhla1 A C 15: 65,820,339 (GRCm39) I137S probably damaging Het
Hivep1 A G 13: 42,337,934 (GRCm39) H2671R possibly damaging Het
Hltf A G 3: 20,113,098 (GRCm39) Y19C probably damaging Het
Hsd3b2 A T 3: 98,619,333 (GRCm39) M204K probably benign Het
Hspa4l A T 3: 40,736,031 (GRCm39) I551F probably benign Het
Itpkc A T 7: 26,927,490 (GRCm39) D141E probably damaging Het
Kcnc3 A G 7: 44,248,296 (GRCm39) D757G probably benign Het
Mettl16 A T 11: 74,678,474 (GRCm39) Y141F probably damaging Het
Mfng G A 15: 78,640,840 (GRCm39) R302C probably damaging Het
Mogs T A 6: 83,094,363 (GRCm39) S393R probably damaging Het
Mrps28 A G 3: 8,965,044 (GRCm39) probably null Het
Nfat5 T C 8: 108,093,765 (GRCm39) S150P probably benign Het
Or2w1 T C 13: 21,316,978 (GRCm39) V11A probably benign Het
Or7d10 A T 9: 19,832,237 (GRCm39) H244L probably damaging Het
Pcdh12 A G 18: 38,416,805 (GRCm39) S107P probably damaging Het
Phf21a G A 2: 92,182,120 (GRCm39) D463N probably damaging Het
Picalm A C 7: 89,844,908 (GRCm39) I567L probably benign Het
Pla2g4a T A 1: 149,808,428 (GRCm39) D5V possibly damaging Het
Sspo C T 6: 48,428,305 (GRCm39) T222M probably benign Het
Stk31 A T 6: 49,446,243 (GRCm39) D982V probably damaging Het
Tas2r113 C T 6: 132,870,644 (GRCm39) T224I probably damaging Het
Tbc1d15 T C 10: 115,055,112 (GRCm39) D310G probably damaging Het
Tcf12 G T 9: 71,766,229 (GRCm39) T468K possibly damaging Het
Tenm4 A G 7: 96,171,640 (GRCm39) probably benign Het
Tet2 A G 3: 133,172,542 (GRCm39) Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,388 (GRCm39) probably null Het
Tln1 T A 4: 43,539,508 (GRCm39) T1605S probably benign Het
Trp53bp1 T C 2: 121,087,083 (GRCm39) Y191C probably benign Het
Ugcg T A 4: 59,220,272 (GRCm39) I355N probably damaging Het
Vmn1r21 A T 6: 57,820,891 (GRCm39) D184E probably damaging Het
Vsig10l T A 7: 43,117,439 (GRCm39) D575E probably damaging Het
Zan G A 5: 137,462,791 (GRCm39) T796I unknown Het
Zfp639 A G 3: 32,573,271 (GRCm39) D61G probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120,532,328 (GRCm39) missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120,528,960 (GRCm39) missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120,529,200 (GRCm39) missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120,531,849 (GRCm39) missense probably benign 0.04
IGL01394:Stard9 APN 2 120,536,808 (GRCm39) missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120,504,085 (GRCm39) missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120,533,811 (GRCm39) missense probably damaging 1.00
IGL01810:Stard9 APN 2 120,529,565 (GRCm39) missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120,536,927 (GRCm39) missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120,498,497 (GRCm39) missense probably damaging 1.00
IGL02031:Stard9 APN 2 120,532,820 (GRCm39) missense probably benign 0.27
IGL02081:Stard9 APN 2 120,495,391 (GRCm39) missense probably damaging 0.98
IGL02558:Stard9 APN 2 120,527,388 (GRCm39) missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120,529,473 (GRCm39) missense probably damaging 1.00
IGL02873:Stard9 APN 2 120,544,288 (GRCm39) missense probably damaging 1.00
IGL03195:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
IGL03204:Stard9 APN 2 120,536,283 (GRCm39) missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120,526,566 (GRCm39) small insertion probably benign
IGL03014:Stard9 UTSW 2 120,532,675 (GRCm39) unclassified probably benign
PIT4151001:Stard9 UTSW 2 120,533,237 (GRCm39) nonsense probably null
PIT4498001:Stard9 UTSW 2 120,527,916 (GRCm39) missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0027:Stard9 UTSW 2 120,533,982 (GRCm39) missense probably benign
R0038:Stard9 UTSW 2 120,526,313 (GRCm39) missense probably benign
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0049:Stard9 UTSW 2 120,530,300 (GRCm39) missense probably damaging 1.00
R0116:Stard9 UTSW 2 120,464,736 (GRCm39) missense probably damaging 0.99
R0398:Stard9 UTSW 2 120,526,788 (GRCm39) missense probably benign 0.03
R0479:Stard9 UTSW 2 120,528,077 (GRCm39) missense probably damaging 1.00
R0556:Stard9 UTSW 2 120,529,404 (GRCm39) missense probably benign 0.09
R0589:Stard9 UTSW 2 120,529,028 (GRCm39) missense probably benign 0.00
R0609:Stard9 UTSW 2 120,536,787 (GRCm39) missense probably damaging 1.00
R0611:Stard9 UTSW 2 120,529,738 (GRCm39) missense probably benign 0.00
R0683:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0751:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign 0.04
R0833:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120,527,480 (GRCm39) missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120,531,323 (GRCm39) missense probably damaging 1.00
R0848:Stard9 UTSW 2 120,526,304 (GRCm39) missense probably damaging 1.00
R0849:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R0961:Stard9 UTSW 2 120,523,920 (GRCm39) missense probably benign 0.01
R0993:Stard9 UTSW 2 120,535,650 (GRCm39) missense probably damaging 1.00
R1005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1006:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1115:Stard9 UTSW 2 120,523,331 (GRCm39) missense probably benign 0.05
R1163:Stard9 UTSW 2 120,526,694 (GRCm39) missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1200:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1331:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1332:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1333:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1334:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1335:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1336:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1338:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1346:Stard9 UTSW 2 120,543,929 (GRCm39) missense probably damaging 1.00
R1370:Stard9 UTSW 2 120,527,958 (GRCm39) missense probably benign 0.11
R1384:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1401:Stard9 UTSW 2 120,543,328 (GRCm39) splice site probably benign
R1416:Stard9 UTSW 2 120,531,453 (GRCm39) missense probably benign 0.00
R1453:Stard9 UTSW 2 120,496,857 (GRCm39) missense probably damaging 1.00
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120,533,678 (GRCm39) missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120,532,533 (GRCm39) missense probably benign 0.09
R1538:Stard9 UTSW 2 120,527,192 (GRCm39) missense probably benign 0.25
R1614:Stard9 UTSW 2 120,528,156 (GRCm39) missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120,534,203 (GRCm39) missense probably benign 0.37
R1658:Stard9 UTSW 2 120,532,023 (GRCm39) missense probably benign 0.02
R1686:Stard9 UTSW 2 120,529,973 (GRCm39) missense probably benign 0.00
R1797:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1803:Stard9 UTSW 2 120,531,970 (GRCm39) missense probably benign 0.24
R1806:Stard9 UTSW 2 120,509,934 (GRCm39) splice site probably null
R1847:Stard9 UTSW 2 120,528,970 (GRCm39) missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120,519,232 (GRCm39) missense probably damaging 1.00
R1892:Stard9 UTSW 2 120,524,189 (GRCm39) missense probably benign 0.01
R1906:Stard9 UTSW 2 120,526,908 (GRCm39) missense probably benign 0.00
R1907:Stard9 UTSW 2 120,544,293 (GRCm39) missense probably damaging 1.00
R1930:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R1933:Stard9 UTSW 2 120,529,137 (GRCm39) missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120,531,887 (GRCm39) missense probably benign
R1999:Stard9 UTSW 2 120,523,349 (GRCm39) missense probably damaging 0.99
R2004:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,504,117 (GRCm39) missense probably damaging 1.00
R2005:Stard9 UTSW 2 120,495,426 (GRCm39) missense possibly damaging 0.90
R2021:Stard9 UTSW 2 120,534,716 (GRCm39) missense probably benign 0.05
R2025:Stard9 UTSW 2 120,532,879 (GRCm39) missense probably benign 0.20
R2190:Stard9 UTSW 2 120,544,601 (GRCm39) missense probably benign 0.22
R2204:Stard9 UTSW 2 120,529,012 (GRCm39) frame shift probably null
R2422:Stard9 UTSW 2 120,530,765 (GRCm39) missense probably benign 0.29
R3401:Stard9 UTSW 2 120,534,170 (GRCm39) missense probably damaging 0.98
R3618:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120,529,500 (GRCm39) missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120,544,030 (GRCm39) missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120,528,710 (GRCm39) missense probably benign 0.11
R4022:Stard9 UTSW 2 120,534,636 (GRCm39) missense probably benign 0.05
R4223:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120,495,472 (GRCm39) missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120,532,427 (GRCm39) missense probably benign 0.43
R4382:Stard9 UTSW 2 120,464,703 (GRCm39) missense probably damaging 1.00
R4453:Stard9 UTSW 2 120,528,272 (GRCm39) missense probably benign
R4499:Stard9 UTSW 2 120,530,722 (GRCm39) missense probably benign 0.05
R4524:Stard9 UTSW 2 120,526,926 (GRCm39) missense probably damaging 1.00
R4671:Stard9 UTSW 2 120,529,121 (GRCm39) missense probably damaging 0.98
R4701:Stard9 UTSW 2 120,536,194 (GRCm39) missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120,526,604 (GRCm39) missense probably benign 0.01
R4822:Stard9 UTSW 2 120,526,422 (GRCm39) missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120,533,594 (GRCm39) missense probably benign 0.18
R4863:Stard9 UTSW 2 120,531,341 (GRCm39) missense probably benign 0.00
R4898:Stard9 UTSW 2 120,536,900 (GRCm39) nonsense probably null
R5033:Stard9 UTSW 2 120,523,880 (GRCm39) missense probably benign 0.00
R5087:Stard9 UTSW 2 120,527,500 (GRCm39) nonsense probably null
R5157:Stard9 UTSW 2 120,528,342 (GRCm39) missense probably benign
R5213:Stard9 UTSW 2 120,529,707 (GRCm39) missense probably damaging 1.00
R5237:Stard9 UTSW 2 120,529,839 (GRCm39) missense probably damaging 0.96
R5257:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5258:Stard9 UTSW 2 120,529,824 (GRCm39) missense probably damaging 0.99
R5273:Stard9 UTSW 2 120,535,568 (GRCm39) missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120,532,428 (GRCm39) missense probably benign 0.43
R5288:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5292:Stard9 UTSW 2 120,529,626 (GRCm39) missense probably benign 0.17
R5328:Stard9 UTSW 2 120,529,711 (GRCm39) missense probably damaging 1.00
R5385:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5386:Stard9 UTSW 2 120,531,111 (GRCm39) missense probably damaging 0.98
R5393:Stard9 UTSW 2 120,533,387 (GRCm39) missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120,524,149 (GRCm39) missense probably benign 0.17
R5685:Stard9 UTSW 2 120,535,803 (GRCm39) missense probably damaging 1.00
R5749:Stard9 UTSW 2 120,534,267 (GRCm39) missense probably damaging 1.00
R5780:Stard9 UTSW 2 120,533,877 (GRCm39) missense probably benign 0.02
R5901:Stard9 UTSW 2 120,531,851 (GRCm39) missense probably damaging 1.00
R5941:Stard9 UTSW 2 120,544,039 (GRCm39) missense probably damaging 1.00
R5960:Stard9 UTSW 2 120,530,442 (GRCm39) missense probably benign 0.05
R5966:Stard9 UTSW 2 120,527,580 (GRCm39) missense probably damaging 1.00
R5967:Stard9 UTSW 2 120,537,375 (GRCm39) missense probably damaging 0.99
R6019:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6020:Stard9 UTSW 2 120,524,196 (GRCm39) frame shift probably null
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6036:Stard9 UTSW 2 120,530,556 (GRCm39) missense probably benign 0.09
R6090:Stard9 UTSW 2 120,524,135 (GRCm39) missense probably damaging 0.99
R6192:Stard9 UTSW 2 120,527,241 (GRCm39) missense probably damaging 0.99
R6228:Stard9 UTSW 2 120,544,231 (GRCm39) missense probably damaging 1.00
R6235:Stard9 UTSW 2 120,544,027 (GRCm39) missense probably damaging 1.00
R6280:Stard9 UTSW 2 120,531,608 (GRCm39) missense probably benign
R6338:Stard9 UTSW 2 120,527,966 (GRCm39) missense probably benign
R6344:Stard9 UTSW 2 120,534,801 (GRCm39) missense probably benign 0.12
R6364:Stard9 UTSW 2 120,543,910 (GRCm39) missense probably damaging 1.00
R6383:Stard9 UTSW 2 120,496,888 (GRCm39) critical splice donor site probably null
R6644:Stard9 UTSW 2 120,526,253 (GRCm39) missense probably benign 0.11
R6747:Stard9 UTSW 2 120,528,864 (GRCm39) missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120,531,740 (GRCm39) missense probably damaging 1.00
R6836:Stard9 UTSW 2 120,530,324 (GRCm39) missense probably benign 0.15
R6861:Stard9 UTSW 2 120,535,667 (GRCm39) missense probably benign 0.09
R6872:Stard9 UTSW 2 120,544,549 (GRCm39) nonsense probably null
R6875:Stard9 UTSW 2 120,527,917 (GRCm39) missense probably benign 0.04
R6915:Stard9 UTSW 2 120,533,111 (GRCm39) missense probably benign 0.00
R6934:Stard9 UTSW 2 120,528,176 (GRCm39) missense probably benign 0.00
R6943:Stard9 UTSW 2 120,532,677 (GRCm39) missense probably benign 0.29
R7009:Stard9 UTSW 2 120,527,672 (GRCm39) missense probably benign 0.37
R7031:Stard9 UTSW 2 120,530,931 (GRCm39) missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120,509,859 (GRCm39) nonsense probably null
R7151:Stard9 UTSW 2 120,526,623 (GRCm39) missense probably benign
R7154:Stard9 UTSW 2 120,535,023 (GRCm39) missense probably benign 0.02
R7154:Stard9 UTSW 2 120,531,795 (GRCm39) missense probably benign 0.00
R7165:Stard9 UTSW 2 120,534,639 (GRCm39) missense probably damaging 1.00
R7260:Stard9 UTSW 2 120,537,419 (GRCm39) missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120,464,755 (GRCm39) nonsense probably null
R7282:Stard9 UTSW 2 120,528,984 (GRCm39) missense probably benign 0.00
R7344:Stard9 UTSW 2 120,535,167 (GRCm39) missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120,497,015 (GRCm39) missense probably benign
R7359:Stard9 UTSW 2 120,528,761 (GRCm39) missense probably damaging 1.00
R7375:Stard9 UTSW 2 120,495,483 (GRCm39) splice site probably null
R7410:Stard9 UTSW 2 120,531,978 (GRCm39) missense probably benign 0.41
R7422:Stard9 UTSW 2 120,532,633 (GRCm39) missense probably benign 0.21
R7475:Stard9 UTSW 2 120,518,591 (GRCm39) missense probably damaging 1.00
R7523:Stard9 UTSW 2 120,530,078 (GRCm39) missense probably benign
R7553:Stard9 UTSW 2 120,524,289 (GRCm39) splice site probably null
R7624:Stard9 UTSW 2 120,518,627 (GRCm39) missense probably benign 0.15
R7761:Stard9 UTSW 2 120,529,860 (GRCm39) missense probably benign 0.00
R7794:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R7819:Stard9 UTSW 2 120,531,465 (GRCm39) missense probably damaging 1.00
R7823:Stard9 UTSW 2 120,532,587 (GRCm39) missense probably damaging 0.96
R7837:Stard9 UTSW 2 120,534,146 (GRCm39) missense probably benign 0.06
R7889:Stard9 UTSW 2 120,534,942 (GRCm39) missense probably benign 0.11
R7905:Stard9 UTSW 2 120,526,562 (GRCm39) missense not run
R7956:Stard9 UTSW 2 120,535,852 (GRCm39) nonsense probably null
R8013:Stard9 UTSW 2 120,518,582 (GRCm39) missense probably damaging 1.00
R8113:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8114:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8116:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R8117:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8118:Stard9 UTSW 2 120,534,911 (GRCm39) missense probably benign 0.01
R8170:Stard9 UTSW 2 120,530,529 (GRCm39) missense possibly damaging 0.76
R8300:Stard9 UTSW 2 120,535,250 (GRCm39) missense possibly damaging 0.71
R8333:Stard9 UTSW 2 120,532,270 (GRCm39) missense probably benign 0.00
R8337:Stard9 UTSW 2 120,510,306 (GRCm39) missense probably damaging 1.00
R8536:Stard9 UTSW 2 120,545,140 (GRCm39) missense possibly damaging 0.93
R8682:Stard9 UTSW 2 120,533,796 (GRCm39) missense possibly damaging 0.65
R8696:Stard9 UTSW 2 120,531,595 (GRCm39) missense probably benign 0.02
R8708:Stard9 UTSW 2 120,534,059 (GRCm39) missense probably damaging 1.00
R8732:Stard9 UTSW 2 120,510,442 (GRCm39) missense probably damaging 1.00
R8798:Stard9 UTSW 2 120,535,212 (GRCm39) missense probably benign 0.09
R8807:Stard9 UTSW 2 120,535,932 (GRCm39) missense probably damaging 1.00
R8807:Stard9 UTSW 2 120,535,943 (GRCm39) missense probably damaging 1.00
R8862:Stard9 UTSW 2 120,534,099 (GRCm39) missense probably benign
R8920:Stard9 UTSW 2 120,533,088 (GRCm39) missense probably damaging 0.96
R9026:Stard9 UTSW 2 120,536,283 (GRCm39) missense probably damaging 1.00
R9048:Stard9 UTSW 2 120,508,415 (GRCm39) missense probably damaging 0.99
R9049:Stard9 UTSW 2 120,510,418 (GRCm39) missense probably benign 0.30
R9152:Stard9 UTSW 2 120,529,068 (GRCm39) missense probably damaging 0.99
R9189:Stard9 UTSW 2 120,533,500 (GRCm39) missense possibly damaging 0.95
R9238:Stard9 UTSW 2 120,528,447 (GRCm39) missense probably damaging 1.00
R9372:Stard9 UTSW 2 120,495,420 (GRCm39) nonsense probably null
R9393:Stard9 UTSW 2 120,518,656 (GRCm39) missense possibly damaging 0.88
R9444:Stard9 UTSW 2 120,495,414 (GRCm39) missense probably damaging 1.00
R9514:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9515:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9516:Stard9 UTSW 2 120,534,564 (GRCm39) missense probably damaging 1.00
R9570:Stard9 UTSW 2 120,534,714 (GRCm39) missense probably benign 0.02
R9649:Stard9 UTSW 2 120,526,635 (GRCm39) missense probably benign 0.20
R9789:Stard9 UTSW 2 120,510,417 (GRCm39) missense probably damaging 1.00
X0023:Stard9 UTSW 2 120,533,444 (GRCm39) missense possibly damaging 0.92
X0023:Stard9 UTSW 2 120,533,225 (GRCm39) missense probably benign 0.00
Z1176:Stard9 UTSW 2 120,528,803 (GRCm39) missense probably damaging 1.00
Z1176:Stard9 UTSW 2 120,527,093 (GRCm39) missense probably benign
Z1176:Stard9 UTSW 2 120,526,299 (GRCm39) missense probably benign 0.01
Z1177:Stard9 UTSW 2 120,504,157 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCAACATGCCCAGATTCTC -3'
(R):5'- TGCACGAGGAGCTGTTATCAAG -3'

Sequencing Primer
(F):5'- CAGAAAAGGTTGTGTGGCT -3'
(R):5'- GAAGTAATCTCTCAGAGCTTTTTCC -3'
Posted On 2017-06-26