Mutagenetix > Incidental Mutations

Incidental Mutation 'R6012:Tln1'

479799

Institutional Source

Beutler Lab

Gene Symbol

Tln1

Ensembl Gene

ENSMUSG00000028465

Gene Name

talin 1

Synonyms

MMRRC Submission

044188-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6012 (G1)

Quality Score

208.009

Status

Validated

Chromosome

Chromosomal Location

43531519-43562691 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43539508 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1605 (T1605S)

Ref Sequence

ENSEMBL: ENSMUSP00000030187 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030187]

PDB Structure

Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<

Predicted Effect

probably benign
Transcript: ENSMUST00000030187
AA Change: T1605S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: T1605S

Domain	Start	End	E-Value	Type
Blast:B41	2	76	5e-31	BLAST
B41	82	313	4.66e-73	SMART
IRS	308	401	7.65e-16	SMART
Pfam:Talin_middle	491	652	8.2e-60	PFAM
low complexity region	671	690	N/A	INTRINSIC
internal_repeat_2	699	760	8.94e-6	PROSPERO
low complexity region	766	775	N/A	INTRINSIC
PDB:1ZVZ\|B	820	844	2e-7	PDB
low complexity region	866	879	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
PDB:2LQG\|A	913	1044	2e-44	PDB
PDB:2L7N\|A	1046	1207	1e-101	PDB
Pfam:VBS	1234	1358	9.6e-8	PFAM
internal_repeat_2	1488	1549	8.94e-6	PROSPERO
internal_repeat_3	1623	1769	4.92e-5	PROSPERO
low complexity region	1817	1828	N/A	INTRINSIC
Pfam:VBS	1849	1973	6.2e-67	PFAM
PDB:3DYJ\|B	1974	2293	N/A	PDB
low complexity region	2305	2327	N/A	INTRINSIC
ILWEQ	2336	2533	2.93e-105	SMART

Meta Mutation Damage Score

0.0576

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.4%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	T	A	16: 8,582,827	Y97N	probably damaging	Het
Akr1b10	A	T	6: 34,387,780	I59F	probably damaging	Het
Als2	A	T	1: 59,185,215	D1076E	probably damaging	Het
Bank1	T	C	3: 136,213,837	D266G	probably benign	Het
Bmp2k	T	A	5: 97,063,608		probably null	Het
Cdc42bpa	A	G	1: 180,065,090	Y273C	probably damaging	Het
Chfr	G	T	5: 110,144,651		probably null	Het
Dapk1	A	T	13: 60,761,662	Q1363L	probably benign	Het
Ddx23	A	T	15: 98,650,770	D352E	possibly damaging	Het
Ect2	T	C	3: 27,098,325		probably benign	Het
Efcab10	A	C	12: 33,398,593	D107A	probably damaging	Het
Fcgr4	G	A	1: 171,025,664	G146D	possibly damaging	Het
Fgd5	A	G	6: 91,989,341	T694A	possibly damaging	Het
Ghr	T	C	15: 3,340,927	D152G	probably damaging	Het
Gli2	A	C	1: 118,837,715	L902R	probably damaging	Het
Glis2	G	A	16: 4,611,308	G125D	possibly damaging	Het
Gm9774	C	A	3: 92,429,484		probably null	Het
Gmcl1	A	G	6: 86,721,412	Y168H	probably damaging	Het
Golga4	A	G	9: 118,559,696	K1962R	possibly damaging	Het
Hebp1	T	A	6: 135,168,057	E14V	probably damaging	Het
Hhla1	A	C	15: 65,948,490	I137S	probably damaging	Het
Hivep1	A	G	13: 42,184,458	H2671R	possibly damaging	Het
Hltf	A	G	3: 20,058,934	Y19C	probably damaging	Het
Hsd3b2	A	T	3: 98,712,017	M204K	probably benign	Het
Hspa4l	A	T	3: 40,781,599	I551F	probably benign	Het
Itpkc	A	T	7: 27,228,065	D141E	probably damaging	Het
Kcnc3	A	G	7: 44,598,872	D757G	probably benign	Het
Mettl16	A	T	11: 74,787,648	Y141F	probably damaging	Het
Mfng	G	A	15: 78,756,640	R302C	probably damaging	Het
Mogs	T	A	6: 83,117,382	S393R	probably damaging	Het
Mrps28	A	G	3: 8,899,984		probably null	Het
Nfat5	T	C	8: 107,367,133	S150P	probably benign	Het
Olfr263	T	C	13: 21,132,808	V11A	probably benign	Het
Olfr77	A	T	9: 19,920,941	H244L	probably damaging	Het
Pcdh12	A	G	18: 38,283,752	S107P	probably damaging	Het
Phf21a	G	A	2: 92,351,775	D463N	probably damaging	Het
Picalm	A	C	7: 90,195,700	I567L	probably benign	Het
Pla2g4a	T	A	1: 149,932,677	D5V	possibly damaging	Het
Sspo	C	T	6: 48,451,371	T222M	probably benign	Het
Stard9	T	C	2: 120,704,586	S3775P	probably damaging	Het
Stk31	A	T	6: 49,469,309	D982V	probably damaging	Het
Tas2r113	C	T	6: 132,893,681	T224I	probably damaging	Het
Tbc1d15	T	C	10: 115,219,207	D310G	probably damaging	Het
Tcf12	G	T	9: 71,858,947	T468K	possibly damaging	Het
Tenm4	A	G	7: 96,522,433		probably benign	Het
Tet2	A	G	3: 133,466,781	Y1907H	possibly damaging	Het
Thsd7a	T	C	6: 12,379,389		probably null	Het
Trp53bp1	T	C	2: 121,256,602	Y191C	probably benign	Het
Ugcg	T	A	4: 59,220,272	I355N	probably damaging	Het
Vmn1r21	A	T	6: 57,843,906	D184E	probably damaging	Het
Vsig10l	T	A	7: 43,468,015	D575E	probably damaging	Het
Zan	G	A	5: 137,464,529	T796I	unknown	Het
Zfp639	A	G	3: 32,519,122	D61G	probably damaging	Het

Other mutations in Tln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Tln1	APN	4	43542719	missense	probably benign	0.22
IGL00987:Tln1	APN	4	43551297	unclassified	probably benign
IGL01345:Tln1	APN	4	43536281	missense	probably damaging	1.00
IGL01456:Tln1	APN	4	43543432	unclassified	probably benign
IGL01715:Tln1	APN	4	43555890	missense	probably damaging	1.00
IGL01750:Tln1	APN	4	43545435	missense	probably damaging	1.00
IGL01933:Tln1	APN	4	43539508	missense	probably benign
IGL01933:Tln1	APN	4	43555894	missense	possibly damaging	0.52
IGL02119:Tln1	APN	4	43546760	missense	probably damaging	0.99
IGL02148:Tln1	APN	4	43555388	missense	probably damaging	1.00
IGL02153:Tln1	APN	4	43546857	missense	possibly damaging	0.76
IGL02522:Tln1	APN	4	43540612	missense	probably benign	0.07
IGL02691:Tln1	APN	4	43539544	missense	probably benign	0.42
IGL02882:Tln1	APN	4	43539522	missense	probably benign	0.45
IGL02892:Tln1	APN	4	43555679	missense	probably damaging	1.00
IGL03061:Tln1	APN	4	43545694	missense	probably damaging	1.00
IGL03102:Tln1	APN	4	43532861	missense	possibly damaging	0.89
IGL03183:Tln1	APN	4	43539084	splice site	probably benign
H8786:Tln1	UTSW	4	43544589	missense	probably damaging	0.97
PIT4576001:Tln1	UTSW	4	43539998	missense	probably damaging	1.00
PIT4696001:Tln1	UTSW	4	43542701	critical splice donor site	probably null
R0206:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0208:Tln1	UTSW	4	43549151	missense	probably damaging	1.00
R0454:Tln1	UTSW	4	43553504	missense	probably benign
R0539:Tln1	UTSW	4	43543434	critical splice donor site	probably null
R0548:Tln1	UTSW	4	43542709	missense	possibly damaging	0.79
R0561:Tln1	UTSW	4	43550304	missense	possibly damaging	0.94
R0606:Tln1	UTSW	4	43547756	missense	probably benign	0.34
R0607:Tln1	UTSW	4	43553071	missense	probably damaging	1.00
R0609:Tln1	UTSW	4	43544645	missense	possibly damaging	0.63
R0847:Tln1	UTSW	4	43555333	missense	probably damaging	1.00
R0993:Tln1	UTSW	4	43549825	missense	probably benign	0.22
R1255:Tln1	UTSW	4	43538044	missense	probably damaging	1.00
R1292:Tln1	UTSW	4	43534578	critical splice donor site	probably null
R1752:Tln1	UTSW	4	43536311	missense	probably damaging	1.00
R2169:Tln1	UTSW	4	43548005	missense	probably damaging	1.00
R2172:Tln1	UTSW	4	43545721	missense	probably benign
R2202:Tln1	UTSW	4	43553083	unclassified	probably null
R2680:Tln1	UTSW	4	43539668	missense	probably damaging	1.00
R3012:Tln1	UTSW	4	43542525	missense	probably benign
R3714:Tln1	UTSW	4	43540597	missense	probably damaging	1.00
R3735:Tln1	UTSW	4	43549370	missense	probably damaging	0.97
R3794:Tln1	UTSW	4	43536295	missense	probably damaging	1.00
R3825:Tln1	UTSW	4	43536413	splice site	probably benign
R3983:Tln1	UTSW	4	43553030	missense	probably damaging	1.00
R4061:Tln1	UTSW	4	43549177	missense	probably damaging	1.00
R4249:Tln1	UTSW	4	43536104	missense	probably damaging	1.00
R4287:Tln1	UTSW	4	43543509	missense	probably benign	0.01
R4471:Tln1	UTSW	4	43551018	missense	probably benign	0.03
R4562:Tln1	UTSW	4	43533598	missense	probably damaging	1.00
R4654:Tln1	UTSW	4	43535954	missense	probably null	1.00
R4737:Tln1	UTSW	4	43540588	missense	probably benign	0.00
R4936:Tln1	UTSW	4	43547522	missense	possibly damaging	0.83
R5225:Tln1	UTSW	4	43539406	missense	probably benign	0.06
R5288:Tln1	UTSW	4	43540661	missense	probably benign	0.06
R5421:Tln1	UTSW	4	43533609	missense	possibly damaging	0.80
R5445:Tln1	UTSW	4	43543905	missense	probably benign	0.26
R5660:Tln1	UTSW	4	43547732	missense	probably damaging	1.00
R5772:Tln1	UTSW	4	43545191	missense	probably benign	0.13
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6038:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6039:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6052:Tln1	UTSW	4	43555052	missense	probably damaging	0.99
R6145:Tln1	UTSW	4	43538030	missense	possibly damaging	0.64
R6157:Tln1	UTSW	4	43534744	missense	probably benign	0.06
R6242:Tln1	UTSW	4	43533145	missense	probably damaging	1.00
R6454:Tln1	UTSW	4	43533866	missense	probably damaging	0.99
R6467:Tln1	UTSW	4	43543165	missense	probably benign	0.42
R6548:Tln1	UTSW	4	43547525	missense	probably damaging	0.98
R6576:Tln1	UTSW	4	43555419	splice site	probably null
R6722:Tln1	UTSW	4	43547618	missense	probably damaging	1.00
R6968:Tln1	UTSW	4	43550217	missense	probably benign	0.02
R7000:Tln1	UTSW	4	43556302	missense	probably damaging	0.96
R7137:Tln1	UTSW	4	43540616	missense	probably damaging	1.00
R7242:Tln1	UTSW	4	43542602	missense	probably benign	0.01
R7294:Tln1	UTSW	4	43534399	missense	probably benign	0.02
R7312:Tln1	UTSW	4	43545922	missense	probably damaging	1.00
R7547:Tln1	UTSW	4	43545206	missense	possibly damaging	0.80
RF021:Tln1	UTSW	4	43555890	missense	probably damaging	1.00
X0052:Tln1	UTSW	4	43533125	critical splice donor site	probably null
X0063:Tln1	UTSW	4	43548015	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCACATTGTTTGTCCCCAG -3'
(R):5'- CTCTGCTGGAAGCTGTGGATAAC -3'

Sequencing Primer
(F):5'- GTTTGTCCCCAGCCACACATG -3'
(R):5'- GGATAACCTGAGTGCCTTTGCC -3'

Posted On

2017-06-26