Mutagenetix > Incidental Mutations

Incidental Mutation 'R6012:Chfr'

479801

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

044188-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.242) question?

Stock #

R6012 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 110144651 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000198633] [ENSMUST00000199283] [ENSMUST00000199557] [ENSMUST00000199672] [ENSMUST00000199811]

Predicted Effect

probably null
Transcript: ENSMUST00000014812

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000014812

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000112519

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197010

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably null
Transcript: ENSMUST00000198633

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000198633

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199283

SMART Domains

Protein: ENSMUSP00000143389
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	50	7e-6	SMART
PDB:1LGQ\|B	16	50	8e-12	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Predicted Effect

probably benign
Transcript: ENSMUST00000199811

SMART Domains

Protein: ENSMUSP00000143737
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	5.3e-9	SMART

Meta Mutation Damage Score

0.9589

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.4%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	T	A	16: 8,582,827	Y97N	probably damaging	Het
Akr1b10	A	T	6: 34,387,780	I59F	probably damaging	Het
Als2	A	T	1: 59,185,215	D1076E	probably damaging	Het
Bank1	T	C	3: 136,213,837	D266G	probably benign	Het
Bmp2k	T	A	5: 97,063,608		probably null	Het
Cdc42bpa	A	G	1: 180,065,090	Y273C	probably damaging	Het
Dapk1	A	T	13: 60,761,662	Q1363L	probably benign	Het
Ddx23	A	T	15: 98,650,770	D352E	possibly damaging	Het
Ect2	T	C	3: 27,098,325		probably benign	Het
Efcab10	A	C	12: 33,398,593	D107A	probably damaging	Het
Fcgr4	G	A	1: 171,025,664	G146D	possibly damaging	Het
Fgd5	A	G	6: 91,989,341	T694A	possibly damaging	Het
Ghr	T	C	15: 3,340,927	D152G	probably damaging	Het
Gli2	A	C	1: 118,837,715	L902R	probably damaging	Het
Glis2	G	A	16: 4,611,308	G125D	possibly damaging	Het
Gm9774	C	A	3: 92,429,484		probably null	Het
Gmcl1	A	G	6: 86,721,412	Y168H	probably damaging	Het
Golga4	A	G	9: 118,559,696	K1962R	possibly damaging	Het
Hebp1	T	A	6: 135,168,057	E14V	probably damaging	Het
Hhla1	A	C	15: 65,948,490	I137S	probably damaging	Het
Hivep1	A	G	13: 42,184,458	H2671R	possibly damaging	Het
Hltf	A	G	3: 20,058,934	Y19C	probably damaging	Het
Hsd3b2	A	T	3: 98,712,017	M204K	probably benign	Het
Hspa4l	A	T	3: 40,781,599	I551F	probably benign	Het
Itpkc	A	T	7: 27,228,065	D141E	probably damaging	Het
Kcnc3	A	G	7: 44,598,872	D757G	probably benign	Het
Mettl16	A	T	11: 74,787,648	Y141F	probably damaging	Het
Mfng	G	A	15: 78,756,640	R302C	probably damaging	Het
Mogs	T	A	6: 83,117,382	S393R	probably damaging	Het
Mrps28	A	G	3: 8,899,984		probably null	Het
Nfat5	T	C	8: 107,367,133	S150P	probably benign	Het
Olfr263	T	C	13: 21,132,808	V11A	probably benign	Het
Olfr77	A	T	9: 19,920,941	H244L	probably damaging	Het
Pcdh12	A	G	18: 38,283,752	S107P	probably damaging	Het
Phf21a	G	A	2: 92,351,775	D463N	probably damaging	Het
Picalm	A	C	7: 90,195,700	I567L	probably benign	Het
Pla2g4a	T	A	1: 149,932,677	D5V	possibly damaging	Het
Sspo	C	T	6: 48,451,371	T222M	probably benign	Het
Stard9	T	C	2: 120,704,586	S3775P	probably damaging	Het
Stk31	A	T	6: 49,469,309	D982V	probably damaging	Het
Tas2r113	C	T	6: 132,893,681	T224I	probably damaging	Het
Tbc1d15	T	C	10: 115,219,207	D310G	probably damaging	Het
Tcf12	G	T	9: 71,858,947	T468K	possibly damaging	Het
Tenm4	A	G	7: 96,522,433		probably benign	Het
Tet2	A	G	3: 133,466,781	Y1907H	possibly damaging	Het
Thsd7a	T	C	6: 12,379,389		probably null	Het
Tln1	T	A	4: 43,539,508	T1605S	probably benign	Het
Trp53bp1	T	C	2: 121,256,602	Y191C	probably benign	Het
Ugcg	T	A	4: 59,220,272	I355N	probably damaging	Het
Vmn1r21	A	T	6: 57,843,906	D184E	probably damaging	Het
Vsig10l	T	A	7: 43,468,015	D575E	probably damaging	Het
Zan	G	A	5: 137,464,529	T796I	unknown	Het
Zfp639	A	G	3: 32,519,122	D61G	probably damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGAGACCATTTTCCCCTTTGG -3'
(R):5'- CTGGACCTGAGCAATCTTTGG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GCAATCTTTGGTCACATGGAAC -3'

Posted On

2017-06-26