Incidental Mutation 'R6012:Tbc1d15'
ID479821
Institutional Source Beutler Lab
Gene Symbol Tbc1d15
Ensembl Gene ENSMUSG00000020130
Gene NameTBC1 domain family, member 15
SynonymsLy6dl, 4432405K22Rik
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location115197872-115251467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115219207 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 310 (D310G)
Ref Sequence ENSEMBL: ENSMUSP00000020339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020339]
Predicted Effect probably damaging
Transcript: ENSMUST00000020339
AA Change: D310G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020339
Gene: ENSMUSG00000020130
AA Change: D310G

DomainStartEndE-ValueType
Pfam:DUF3548 6 224 1.3e-87 PFAM
TBC 326 564 1.14e-50 SMART
Blast:TBC 602 671 5e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217843
Meta Mutation Damage Score 0.7423 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-like proteins in brain-GTPase activating protein superfamily that share a conserved Tre-2/Bub2/Cdc16 domain. The encoded protein interacts with Ras-like protein in brain 5A and may function as a regulator of intracellular trafficking. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hhla1 A C 15: 65,948,490 I137S probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Tbc1d15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Tbc1d15 APN 10 115209641 nonsense probably null
IGL01161:Tbc1d15 APN 10 115202530 missense probably benign 0.01
IGL02458:Tbc1d15 APN 10 115229206 missense probably damaging 0.99
IGL03145:Tbc1d15 APN 10 115202516 missense probably benign 0.03
R0140:Tbc1d15 UTSW 10 115220219 missense probably damaging 0.99
R0466:Tbc1d15 UTSW 10 115219172 missense probably damaging 1.00
R0617:Tbc1d15 UTSW 10 115239299 missense probably damaging 1.00
R0633:Tbc1d15 UTSW 10 115220310 missense probably benign 0.00
R1526:Tbc1d15 UTSW 10 115203230 missense probably benign 0.38
R1699:Tbc1d15 UTSW 10 115220314 missense probably benign 0.05
R1727:Tbc1d15 UTSW 10 115210225 missense probably damaging 1.00
R2063:Tbc1d15 UTSW 10 115229173 missense probably benign
R2111:Tbc1d15 UTSW 10 115240914 missense possibly damaging 0.88
R4751:Tbc1d15 UTSW 10 115202587 missense probably damaging 1.00
R5318:Tbc1d15 UTSW 10 115208969 nonsense probably null
R5480:Tbc1d15 UTSW 10 115233218 missense probably damaging 1.00
R5746:Tbc1d15 UTSW 10 115210279 missense probably damaging 1.00
R5891:Tbc1d15 UTSW 10 115220308 missense probably benign 0.20
R6306:Tbc1d15 UTSW 10 115233243 missense possibly damaging 0.91
R6989:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
R7792:Tbc1d15 UTSW 10 115221587 missense possibly damaging 0.91
R8134:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
R8231:Tbc1d15 UTSW 10 115229140 missense probably damaging 1.00
R8507:Tbc1d15 UTSW 10 115202502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGACATCTGCAAACTCAGCAC -3'
(R):5'- ATGGAGGAGCAGTAACGCTC -3'

Sequencing Primer
(F):5'- GCACTCGGCACTGTAAGC -3'
(R):5'- CCTGCCTGAGAAACAGTGTCTTAG -3'
Posted On2017-06-26