Incidental Mutation 'R6012:Hhla1'
ID479829
Institutional Source Beutler Lab
Gene Symbol Hhla1
Ensembl Gene ENSMUSG00000072511
Gene NameHERV-H LTR-associating 1
SynonymsF930104E18Rik
MMRRC Submission 044188-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6012 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location65922443-65976804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65948490 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 137 (I137S)
Ref Sequence ENSEMBL: ENSMUSP00000098149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100584]
Predicted Effect probably damaging
Transcript: ENSMUST00000100584
AA Change: I137S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098149
Gene: ENSMUSG00000072511
AA Change: I137S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,582,827 Y97N probably damaging Het
Akr1b10 A T 6: 34,387,780 I59F probably damaging Het
Als2 A T 1: 59,185,215 D1076E probably damaging Het
Bank1 T C 3: 136,213,837 D266G probably benign Het
Bmp2k T A 5: 97,063,608 probably null Het
Cdc42bpa A G 1: 180,065,090 Y273C probably damaging Het
Chfr G T 5: 110,144,651 probably null Het
Dapk1 A T 13: 60,761,662 Q1363L probably benign Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Ect2 T C 3: 27,098,325 probably benign Het
Efcab10 A C 12: 33,398,593 D107A probably damaging Het
Fcgr4 G A 1: 171,025,664 G146D possibly damaging Het
Fgd5 A G 6: 91,989,341 T694A possibly damaging Het
Ghr T C 15: 3,340,927 D152G probably damaging Het
Gli2 A C 1: 118,837,715 L902R probably damaging Het
Glis2 G A 16: 4,611,308 G125D possibly damaging Het
Gm9774 C A 3: 92,429,484 probably null Het
Gmcl1 A G 6: 86,721,412 Y168H probably damaging Het
Golga4 A G 9: 118,559,696 K1962R possibly damaging Het
Hebp1 T A 6: 135,168,057 E14V probably damaging Het
Hivep1 A G 13: 42,184,458 H2671R possibly damaging Het
Hltf A G 3: 20,058,934 Y19C probably damaging Het
Hsd3b2 A T 3: 98,712,017 M204K probably benign Het
Hspa4l A T 3: 40,781,599 I551F probably benign Het
Itpkc A T 7: 27,228,065 D141E probably damaging Het
Kcnc3 A G 7: 44,598,872 D757G probably benign Het
Mettl16 A T 11: 74,787,648 Y141F probably damaging Het
Mfng G A 15: 78,756,640 R302C probably damaging Het
Mogs T A 6: 83,117,382 S393R probably damaging Het
Mrps28 A G 3: 8,899,984 probably null Het
Nfat5 T C 8: 107,367,133 S150P probably benign Het
Olfr263 T C 13: 21,132,808 V11A probably benign Het
Olfr77 A T 9: 19,920,941 H244L probably damaging Het
Pcdh12 A G 18: 38,283,752 S107P probably damaging Het
Phf21a G A 2: 92,351,775 D463N probably damaging Het
Picalm A C 7: 90,195,700 I567L probably benign Het
Pla2g4a T A 1: 149,932,677 D5V possibly damaging Het
Sspo C T 6: 48,451,371 T222M probably benign Het
Stard9 T C 2: 120,704,586 S3775P probably damaging Het
Stk31 A T 6: 49,469,309 D982V probably damaging Het
Tas2r113 C T 6: 132,893,681 T224I probably damaging Het
Tbc1d15 T C 10: 115,219,207 D310G probably damaging Het
Tcf12 G T 9: 71,858,947 T468K possibly damaging Het
Tenm4 A G 7: 96,522,433 probably benign Het
Tet2 A G 3: 133,466,781 Y1907H possibly damaging Het
Thsd7a T C 6: 12,379,389 probably null Het
Tln1 T A 4: 43,539,508 T1605S probably benign Het
Trp53bp1 T C 2: 121,256,602 Y191C probably benign Het
Ugcg T A 4: 59,220,272 I355N probably damaging Het
Vmn1r21 A T 6: 57,843,906 D184E probably damaging Het
Vsig10l T A 7: 43,468,015 D575E probably damaging Het
Zan G A 5: 137,464,529 T796I unknown Het
Zfp639 A G 3: 32,519,122 D61G probably damaging Het
Other mutations in Hhla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Hhla1 APN 15 65941961 missense probably damaging 1.00
IGL02531:Hhla1 APN 15 65967407 splice site probably benign
IGL02609:Hhla1 APN 15 65930614 splice site probably benign
IGL02948:Hhla1 APN 15 65942693 missense probably damaging 1.00
IGL03063:Hhla1 APN 15 65941790 missense probably damaging 1.00
IGL03411:Hhla1 APN 15 65930229 critical splice donor site probably null
encroachment UTSW 15 65948485 missense probably damaging 1.00
trespass UTSW 15 65936382 nonsense probably null
P4717OSA:Hhla1 UTSW 15 65924001 missense probably damaging 0.99
R0277:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0323:Hhla1 UTSW 15 65948503 missense probably benign 0.01
R0492:Hhla1 UTSW 15 65936291 missense probably benign
R1546:Hhla1 UTSW 15 65933327 missense probably benign 0.10
R2039:Hhla1 UTSW 15 65936377 missense possibly damaging 0.75
R2112:Hhla1 UTSW 15 65936383 missense probably benign 0.00
R2405:Hhla1 UTSW 15 65936311 nonsense probably null
R4804:Hhla1 UTSW 15 65923099 missense probably benign 0.01
R5512:Hhla1 UTSW 15 65924016 missense probably benign 0.00
R5651:Hhla1 UTSW 15 65941814 missense probably damaging 1.00
R6237:Hhla1 UTSW 15 65941797 missense probably damaging 1.00
R6837:Hhla1 UTSW 15 65948485 missense probably damaging 1.00
R7506:Hhla1 UTSW 15 65936382 nonsense probably null
R7657:Hhla1 UTSW 15 65965459 missense probably damaging 0.99
Z1177:Hhla1 UTSW 15 65941775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTATTGCTCAAACAGTAGCA -3'
(R):5'- ACATCTTTTACCTTGCACATATTCAC -3'

Sequencing Primer
(F):5'- TATTGCTCAAACAGTAGCAGTGCC -3'
(R):5'- GCTTTGTCTGGCTACAAACACAC -3'
Posted On2017-06-26