Incidental Mutation 'R6013:Rnf7'
ID479859
Institutional Source Beutler Lab
Gene Symbol Rnf7
Ensembl Gene ENSMUSG00000051234
Gene Namering finger protein 7
SynonymsSag, Rbx2
MMRRC Submission 044189-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6013 (G1)
Quality Score203.009
Status Validated
Chromosome9
Chromosomal Location96470937-96478675 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 96471734 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 114 (*114W)
Ref Sequence ENSEMBL: ENSMUSP00000052856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057500] [ENSMUST00000071301]
Predicted Effect probably null
Transcript: ENSMUST00000057500
AA Change: *114W
SMART Domains Protein: ENSMUSP00000052856
Gene: ENSMUSG00000051234
AA Change: *114W

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
RING 50 102 6.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071301
SMART Domains Protein: ENSMUSP00000108581
Gene: ENSMUSG00000051234

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Pfam:zf-Apc11 28 77 3.4e-8 PFAM
Pfam:zf-rbx1 29 80 9.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128955
Meta Mutation Damage Score 0.8901 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a highly conserved ring finger protein. It is an essential subunit of SKP1-cullin/CDC53-F box protein ubiquitin ligases, which are a part of the protein degradation machinery important for cell cycle progression and signal transduction. This protein interacts with, and is a substrate of, casein kinase II (CSNK2A1/CKII). The phosphorylation of this protein by CSNK2A1 has been shown to promote the degradation of IkappaBalpha (CHUK/IKK-alpha/IKBKA) and p27Kip1(CDKN1B). Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with defects in angiogenesis, widespread apoptosis, impaired cell cycle progression of neuronal precursors and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C T 3: 6,617,250 probably null Het
Aanat A T 11: 116,596,124 probably null Het
Abca17 A T 17: 24,287,846 V1178E possibly damaging Het
Abcf3 T A 16: 20,550,561 probably null Het
Alk A G 17: 71,900,737 M1001T probably benign Het
Arhgap23 C A 11: 97,500,992 S1445Y probably damaging Het
Atp10a T C 7: 58,797,790 I760T probably benign Het
BC030867 T C 11: 102,255,033 V45A probably benign Het
Cadm1 C T 9: 47,857,274 probably benign Het
Car10 A T 11: 93,185,279 probably benign Het
Casq2 G T 3: 102,145,629 probably null Het
Clec4f T C 6: 83,655,088 I55V probably benign Het
Cngb1 T C 8: 95,284,321 probably benign Het
Csn1s2b A G 5: 87,824,239 probably null Het
Cyp2c39 A C 19: 39,513,525 R119S probably benign Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Ddx43 T C 9: 78,414,285 L412S probably damaging Het
Dnajb12 G A 10: 59,894,341 probably null Het
Ephx2 A G 14: 66,110,242 S56P probably benign Het
Fam83h A G 15: 76,004,000 F496S probably damaging Het
Gcnt4 T C 13: 96,947,278 S361P possibly damaging Het
H2-T23 G T 17: 36,030,582 H332Q probably benign Het
Ift57 G T 16: 49,699,304 probably null Het
Il1rl2 A G 1: 40,351,857 H320R possibly damaging Het
Kansl1 A G 11: 104,350,639 V618A probably benign Het
Kctd3 T C 1: 188,996,468 E157G probably benign Het
Magohb T A 6: 131,293,074 D31V possibly damaging Het
Mdn1 C A 4: 32,715,713 F1993L probably damaging Het
Med29 C A 7: 28,386,993 C130F probably benign Het
Mtmr7 G A 8: 40,581,528 R251C probably damaging Het
Ncor1 T C 11: 62,321,077 I49V probably benign Het
Nfkb1 G T 3: 135,626,684 T109K possibly damaging Het
Pkd1l1 A G 11: 8,869,452 probably null Het
Pkp1 T A 1: 135,883,910 T408S probably damaging Het
Plec A T 15: 76,189,310 D501E possibly damaging Het
Ppil2 T C 16: 17,100,265 N96D probably damaging Het
Prcp A C 7: 92,927,768 Y335S possibly damaging Het
Reg2 T A 6: 78,407,969 Y165N possibly damaging Het
Scg3 T C 9: 75,676,808 D137G probably damaging Het
Serpinb7 T C 1: 107,450,189 V204A probably benign Het
Sez6 C T 11: 77,973,797 H528Y probably damaging Het
Sf3b1 A T 1: 55,000,298 S723T probably damaging Het
Shtn1 T C 19: 58,975,101 D594G probably damaging Het
Sptbn4 A G 7: 27,364,479 L2174P probably damaging Het
Stk25 A G 1: 93,625,459 probably null Het
Tep1 A T 14: 50,861,048 F429I probably damaging Het
Thada T A 17: 84,272,800 I1409F probably benign Het
Tmem2 G A 19: 21,832,039 V928I possibly damaging Het
Usp25 G A 16: 77,077,021 G495E probably benign Het
Washc2 A G 6: 116,254,153 S844G probably damaging Het
Xirp2 A T 2: 67,510,943 H1176L possibly damaging Het
Zfand6 C A 7: 84,632,692 V110L probably benign Het
Zfp30 A G 7: 29,789,421 R8G possibly damaging Het
Other mutations in Rnf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4397:Rnf7 UTSW 9 96478410 missense probably benign 0.00
R4649:Rnf7 UTSW 9 96471830 missense probably benign 0.33
R4790:Rnf7 UTSW 9 96478419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATGTTCCCACAGTCGTG -3'
(R):5'- ACAAGTGGCTTGGGTCTGAG -3'

Sequencing Primer
(F):5'- AAAGATCATTTTCTGGTGTTCTCGC -3'
(R):5'- GGGTCTGAGCCCCTCCC -3'
Posted On2017-06-26