Mutagenetix > Incidental Mutation

Incidental Mutation 'R0513:Wdfy3'

47986

Institutional Source

Beutler Lab

Gene Symbol

Wdfy3

Ensembl Gene

ENSMUSG00000043940

Gene Name

WD repeat and FYVE domain containing 3

Synonyms

D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3

MMRRC Submission

038707-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R0513 (G1)

Quality Score

162

Status

Validated

Chromosome

Chromosomal Location

101832956-102069921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101890789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 2012 (S2012C)

Ref Sequence

ENSEMBL: ENSMUSP00000134244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053177
AA Change: S2012C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: S2012C

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
low complexity region	1408	1417	N/A	INTRINSIC
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2517	2638	3.1e-17	PFAM
Beach	2677	2958	2.54e-217	SMART
WD40	3054	3088	1.28e1	SMART
WD40	3098	3137	7.73e-6	SMART
WD40	3140	3178	8.29e-1	SMART
WD40	3183	3227	3.09e-1	SMART
low complexity region	3253	3274	N/A	INTRINSIC
low complexity region	3307	3318	N/A	INTRINSIC
WD40	3381	3420	1.33e1	SMART
FYVE	3428	3497	3.18e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174598
AA Change: S2012C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: S2012C

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
Pfam:DUF4704	1392	1597	6.6e-11	PFAM
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2588	2656	1.8e-14	PFAM
Beach	2695	2976	2.54e-217	SMART
WD40	3072	3106	1.28e1	SMART
WD40	3116	3155	7.73e-6	SMART
WD40	3158	3196	8.29e-1	SMART
WD40	3201	3245	3.09e-1	SMART
low complexity region	3271	3292	N/A	INTRINSIC
low complexity region	3325	3336	N/A	INTRINSIC
WD40	3399	3438	1.33e1	SMART
FYVE	3446	3515	3.18e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212024
AA Change: S1997C

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.1626

Coding Region Coverage

1x: 99.5%
3x: 98.7%
10x: 96.6%
20x: 92.9%

Validation Efficiency

99% (122/123)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,469,659	T146A	probably benign	Het
4930452B06Rik	A	C	14: 8,536,609	D199E	probably damaging	Het
5830473C10Rik	A	T	5: 90,577,927	T333S	probably benign	Het
6720489N17Rik	A	C	13: 62,605,215	V99G	possibly damaging	Het
Abcg4	A	G	9: 44,281,687	S121P	possibly damaging	Het
Actr2	T	C	11: 20,080,124	T212A	probably damaging	Het
Adcy10	T	A	1: 165,519,519	D368E	probably benign	Het
Anapc15	T	C	7: 101,898,540		probably benign	Het
Aox4	A	G	1: 58,217,519	R67G	probably benign	Het
Aox4	A	G	1: 58,247,300	D697G	probably damaging	Het
Arhgap42	A	T	9: 9,005,765	S755T	probably benign	Het
Atm	A	G	9: 53,503,948	V881A	probably benign	Het
Cd163l1	C	A	7: 140,224,960	C625*	probably null	Het
Cdkal1	C	T	13: 29,625,965		probably benign	Het
Cfap61	C	A	2: 146,035,295	N491K	possibly damaging	Het
Chgb	T	C	2: 132,785,977		probably benign	Het
Chrna1	C	A	2: 73,568,082		probably benign	Het
Chst10	A	G	1: 38,865,763	L283P	probably damaging	Het
Clca3a1	A	G	3: 144,760,562		probably null	Het
Cryzl1	G	T	16: 91,699,287	A1E	possibly damaging	Het
Csnk1a1	T	C	18: 61,576,547	Y213H	probably damaging	Het
Cspg4	A	G	9: 56,898,091	Q2062R	probably benign	Het
Ctnnal1	A	G	4: 56,835,348	C310R	probably benign	Het
D630003M21Rik	T	C	2: 158,200,308	E906G	probably benign	Het
D930048N14Rik	T	C	11: 51,654,928		probably benign	Het
Dag1	G	A	9: 108,208,485	P486S	possibly damaging	Het
Dgkq	A	G	5: 108,656,495	L33P	probably benign	Het
Dlc1	C	T	8: 36,584,010	G856R	probably damaging	Het
Dst	T	A	1: 34,219,531		probably benign	Het
Dtl	A	T	1: 191,569,707	Y79*	probably null	Het
Egfr	T	G	11: 16,872,855	L406R	probably damaging	Het
Elp3	A	T	14: 65,563,246		probably null	Het
Fbxw19	C	A	9: 109,481,553		probably null	Het
Frs2	T	C	10: 117,074,665	E264G	possibly damaging	Het
Fscn2	G	T	11: 120,361,880	V58L	probably damaging	Het
Gm17324	G	A	9: 78,448,725		probably benign	Het
Gm4787	A	T	12: 81,378,312	N357K	probably benign	Het
Gm9956	G	T	10: 56,745,195			Het
Gsg1l	C	T	7: 126,020,623		probably null	Het
Herc1	G	A	9: 66,445,645	V2138M	possibly damaging	Het
Htr2a	T	C	14: 74,706,324	L448P	probably benign	Het
Ing3	C	T	6: 21,970,035	S255L	probably damaging	Het
Ispd	A	T	12: 36,390,468	H125L	probably damaging	Het
Krt78	T	C	15: 101,950,949	D271G	probably damaging	Het
Lmbrd2	T	A	15: 9,194,729	L606H	probably damaging	Het
Lmod1	T	A	1: 135,325,168	N53K	probably damaging	Het
Lsr	G	C	7: 30,958,338	A467G	probably benign	Het
Mbtd1	T	A	11: 93,932,212		probably null	Het
Mill1	T	A	7: 18,264,877	Y337*	probably null	Het
Mlxipl	A	T	5: 135,137,263	Q833L	probably benign	Het
Mon2	C	T	10: 123,038,610	V278M	probably damaging	Het
Mxra8	A	C	4: 155,841,733	M180L	probably benign	Het
Myo18a	A	T	11: 77,811,594		probably benign	Het
Myo1c	T	G	11: 75,665,831		probably null	Het
Myo1g	T	C	11: 6,510,203	T782A	probably benign	Het
Ncapd3	A	G	9: 27,064,105		probably benign	Het
Neb	T	C	2: 52,308,687	D414G	probably damaging	Het
Nedd4l	T	A	18: 65,195,185		probably benign	Het
Nf2	T	C	11: 4,791,185	K343R	possibly damaging	Het
Nfasc	A	T	1: 132,603,846	D733E	possibly damaging	Het
Nolc1	G	A	19: 46,084,159	D699N	probably damaging	Het
Nrbp2	C	T	15: 76,088,976	A45T	probably benign	Het
Obscn	A	G	11: 59,061,522	V3907A	possibly damaging	Het
Olfr11	A	T	13: 21,638,949	D191E	probably benign	Het
Olfr1371	T	C	11: 52,213,749	Q80R	possibly damaging	Het
Olfr145	A	T	9: 37,898,055	Y217F	probably damaging	Het
Pank2	C	T	2: 131,282,606	T290I	probably damaging	Het
Pbx4	T	C	8: 69,864,879	V171A	probably benign	Het
Pcgf1	G	T	6: 83,080,574	V75F	probably damaging	Het
Pik3ca	T	C	3: 32,461,511	S778P	probably damaging	Het
Pld6	T	C	11: 59,785,221	I141M	probably damaging	Het
Polq	T	A	16: 37,094,502	V2508E	probably damaging	Het
Prkca	C	G	11: 108,014,376	D179H	possibly damaging	Het
Pspn	T	C	17: 56,999,720	S70G	probably damaging	Het
Ptchd4	C	T	17: 42,503,746	T846I	probably benign	Het
Reg3g	A	C	6: 78,467,844	Y50*	probably null	Het
Rev3l	C	T	10: 39,828,143	H2062Y	probably benign	Het
Rsph4a	C	T	10: 33,912,991	Q611*	probably null	Het
Scgb1b20	G	A	7: 33,373,314		probably null	Het
Sfxn5	T	C	6: 85,269,973		probably benign	Het
Sh3tc1	T	A	5: 35,700,307	Q1179L	possibly damaging	Het
Skint11	A	G	4: 114,194,565	I37V	probably benign	Het
Slc35f5	T	C	1: 125,576,169		probably benign	Het
Slc8a2	A	C	7: 16,157,339	D768A	probably damaging	Het
Slco6b1	A	G	1: 96,997,184		noncoding transcript	Het
Smurf2	T	A	11: 106,836,105	T453S	probably benign	Het
Spag16	A	G	1: 70,493,768		probably benign	Het
Spindoc	G	A	19: 7,374,144	T205I	probably benign	Het
Stab1	T	C	14: 31,148,945	I1316V	probably benign	Het
Stox2	T	C	8: 47,193,865	R187G	probably damaging	Het
Tcea2	A	C	2: 181,684,481	T93P	probably benign	Het
Tenm4	T	C	7: 96,895,623	M2311T	probably benign	Het
Tmem63a	A	G	1: 180,960,461	Q260R	probably benign	Het
Tnpo2	A	T	8: 85,053,529	H698L	probably benign	Het
Trim33	A	G	3: 103,310,384	D215G	probably damaging	Het
Ttc3	T	A	16: 94,426,212	I727N	probably damaging	Het
Ttn	T	A	2: 76,943,325	K2271N	probably damaging	Het
Ubr2	T	A	17: 46,986,779	K223*	probably null	Het
Ubr4	A	G	4: 139,416,875	M1410V	possibly damaging	Het
Ugt2b35	T	C	5: 87,003,412		probably benign	Het
Ulk4	T	A	9: 121,152,325	H880L	probably benign	Het
Unc80	G	A	1: 66,622,474	C1686Y	possibly damaging	Het
Upf2	T	A	2: 5,957,667	L60Q	unknown	Het
Usf2	A	T	7: 30,954,736		probably benign	Het
Usp21	T	A	1: 171,283,012		probably benign	Het
Usp21	T	A	1: 171,283,014		probably benign	Het
Vmn2r118	T	A	17: 55,610,970	K181*	probably null	Het
Vmn2r124	T	A	17: 18,073,729	S693T	possibly damaging	Het
Vmn2r76	C	A	7: 86,228,779	G470V	probably benign	Het
Vps13c	A	C	9: 67,930,735	I1856L	probably benign	Het
Vps50	C	T	6: 3,520,210	L119F	probably damaging	Het
Zfp142	A	G	1: 74,571,555	V924A	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp235	T	C	7: 24,142,219	S688P	probably damaging	Het
Zfp39	C	T	11: 58,889,987	V650I	probably benign	Het
Zfp82	A	T	7: 30,056,840	N272K	probably damaging	Het
Zfyve21	A	C	12: 111,823,264	D54A	possibly damaging	Het
Zfyve26	C	T	12: 79,244,484	D2116N	probably damaging	Het

Other mutations in Wdfy3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Wdfy3	APN	5	101915338	critical splice donor site	probably null
IGL00567:Wdfy3	APN	5	101912030	splice site	probably benign
IGL01288:Wdfy3	APN	5	101901991	splice site	probably null
IGL01323:Wdfy3	APN	5	101895064	missense	probably damaging	1.00
IGL01352:Wdfy3	APN	5	101944120	missense	probably damaging	1.00
IGL01553:Wdfy3	APN	5	101900031	missense	probably benign
IGL01560:Wdfy3	APN	5	101957486	nonsense	probably null
IGL01566:Wdfy3	APN	5	101896588	splice site	probably benign
IGL01616:Wdfy3	APN	5	101913260	missense	probably damaging	0.97
IGL01630:Wdfy3	APN	5	101907488	missense	probably benign
IGL01791:Wdfy3	APN	5	101937412	missense	probably damaging	1.00
IGL01820:Wdfy3	APN	5	101924081	missense	probably benign	0.11
IGL01953:Wdfy3	APN	5	101895028	nonsense	probably null
IGL02121:Wdfy3	APN	5	101898510	missense	possibly damaging	0.85
IGL02167:Wdfy3	APN	5	101961157	missense	probably damaging	0.98
IGL02321:Wdfy3	APN	5	101922609	missense	probably damaging	0.99
IGL02327:Wdfy3	APN	5	101888192	missense	probably damaging	1.00
IGL02651:Wdfy3	APN	5	101896475	missense	probably benign	0.37
IGL02801:Wdfy3	APN	5	101907587	missense	probably damaging	1.00
IGL02839:Wdfy3	APN	5	101968920	missense	probably damaging	1.00
IGL02870:Wdfy3	APN	5	101855471	missense	probably damaging	1.00
IGL02997:Wdfy3	APN	5	101894912	missense	probably null	1.00
IGL03064:Wdfy3	APN	5	101935997	missense	probably damaging	0.99
IGL03090:Wdfy3	APN	5	101866276	missense	probably damaging	1.00
IGL03211:Wdfy3	APN	5	101844912	splice site	probably benign
IGL03237:Wdfy3	APN	5	101844599	missense	probably damaging	1.00
IGL03264:Wdfy3	APN	5	101900150	missense	probably damaging	1.00
Esurient	UTSW	5	101944103	missense	probably damaging	1.00
IGL02988:Wdfy3	UTSW	5	101929981	missense	probably damaging	0.99
PIT4382001:Wdfy3	UTSW	5	101882961	frame shift	probably null
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0025:Wdfy3	UTSW	5	101845046	missense	probably damaging	0.98
R0031:Wdfy3	UTSW	5	101889295	missense	probably damaging	0.97
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0053:Wdfy3	UTSW	5	101844614	missense	probably damaging	0.97
R0078:Wdfy3	UTSW	5	101888105	missense	possibly damaging	0.57
R0147:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0148:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0279:Wdfy3	UTSW	5	101868092	missense	probably damaging	1.00
R0380:Wdfy3	UTSW	5	101948966	missense	probably damaging	0.99
R0472:Wdfy3	UTSW	5	101957443	missense	probably benign	0.13
R0594:Wdfy3	UTSW	5	101906185	missense	possibly damaging	0.94
R0601:Wdfy3	UTSW	5	101836172	missense	probably benign
R0787:Wdfy3	UTSW	5	101957388	missense	probably damaging	1.00
R0825:Wdfy3	UTSW	5	101870051	missense	probably damaging	1.00
R1122:Wdfy3	UTSW	5	101882966	missense	possibly damaging	0.94
R1167:Wdfy3	UTSW	5	101875931	missense	probably benign
R1350:Wdfy3	UTSW	5	101898552	missense	probably damaging	1.00
R1422:Wdfy3	UTSW	5	101884214	splice site	probably benign
R1446:Wdfy3	UTSW	5	101851310	missense	possibly damaging	0.68
R1452:Wdfy3	UTSW	5	101937738	missense	possibly damaging	0.91
R1457:Wdfy3	UTSW	5	101917579	missense	possibly damaging	0.57
R1543:Wdfy3	UTSW	5	101844081	missense	probably benign
R1633:Wdfy3	UTSW	5	101981548	missense	probably damaging	1.00
R1643:Wdfy3	UTSW	5	101875915	missense	possibly damaging	0.62
R1656:Wdfy3	UTSW	5	101941447	missense	probably damaging	1.00
R1720:Wdfy3	UTSW	5	101926525	frame shift	probably null
R1743:Wdfy3	UTSW	5	101844065	missense	probably benign	0.12
R1745:Wdfy3	UTSW	5	101948929	missense	probably damaging	0.96
R1850:Wdfy3	UTSW	5	101894999	missense	probably damaging	1.00
R1852:Wdfy3	UTSW	5	101915376	missense	probably benign	0.00
R1854:Wdfy3	UTSW	5	101888186	missense	probably benign	0.05
R1880:Wdfy3	UTSW	5	101917435	missense	probably benign	0.05
R1930:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1931:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1956:Wdfy3	UTSW	5	101919409	missense	probably benign	0.30
R1965:Wdfy3	UTSW	5	101951312	missense	probably damaging	1.00
R1997:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R2015:Wdfy3	UTSW	5	101860486	missense	probably null	1.00
R2087:Wdfy3	UTSW	5	101895060	missense	probably damaging	1.00
R2156:Wdfy3	UTSW	5	101898425	critical splice donor site	probably null
R2192:Wdfy3	UTSW	5	101907542	missense	possibly damaging	0.55
R2313:Wdfy3	UTSW	5	101889284	missense	probably damaging	1.00
R2332:Wdfy3	UTSW	5	101888323	splice site	probably benign
R2406:Wdfy3	UTSW	5	101888259	missense	probably damaging	1.00
R2679:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R2857:Wdfy3	UTSW	5	101875930	missense	probably benign	0.04
R2937:Wdfy3	UTSW	5	101944122	missense	probably benign	0.07
R3765:Wdfy3	UTSW	5	101861400	missense	probably damaging	1.00
R3795:Wdfy3	UTSW	5	101937600	missense	probably damaging	1.00
R3937:Wdfy3	UTSW	5	101944239	nonsense	probably null
R3947:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R4024:Wdfy3	UTSW	5	101924095	splice site	probably benign
R4065:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4066:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4110:Wdfy3	UTSW	5	101900058	critical splice donor site	probably null
R4235:Wdfy3	UTSW	5	101922634	critical splice acceptor site	probably null
R4420:Wdfy3	UTSW	5	101910984	missense	probably damaging	0.97
R4620:Wdfy3	UTSW	5	101906145	missense	probably damaging	0.99
R4624:Wdfy3	UTSW	5	101884083	missense	possibly damaging	0.52
R4626:Wdfy3	UTSW	5	101943934	missense	probably damaging	1.00
R4727:Wdfy3	UTSW	5	101930028	missense	probably damaging	0.99
R4794:Wdfy3	UTSW	5	101943943	missense	probably damaging	1.00
R4869:Wdfy3	UTSW	5	101894921	missense	probably damaging	0.98
R4971:Wdfy3	UTSW	5	101948972	nonsense	probably null
R4973:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4976:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4984:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4986:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R5068:Wdfy3	UTSW	5	101894937	missense	probably benign	0.15
R5105:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R5120:Wdfy3	UTSW	5	101868106	missense	possibly damaging	0.85
R5134:Wdfy3	UTSW	5	101944103	missense	probably damaging	1.00
R5139:Wdfy3	UTSW	5	101849267	critical splice donor site	probably null
R5235:Wdfy3	UTSW	5	101847106	missense	probably null	0.03
R5303:Wdfy3	UTSW	5	101952983	missense	probably damaging	1.00
R5368:Wdfy3	UTSW	5	101872858	missense	probably damaging	1.00
R5426:Wdfy3	UTSW	5	101919446	missense	probably damaging	0.97
R5442:Wdfy3	UTSW	5	101896559	missense	probably benign	0.04
R5487:Wdfy3	UTSW	5	101836274	missense	probably damaging	1.00
R5509:Wdfy3	UTSW	5	101861448	missense	possibly damaging	0.69
R5877:Wdfy3	UTSW	5	101869989	missense	probably damaging	1.00
R5988:Wdfy3	UTSW	5	101884138	missense	probably benign	0.00
R6017:Wdfy3	UTSW	5	101851359	missense	probably benign	0.01
R6019:Wdfy3	UTSW	5	101849423	missense	probably damaging	1.00
R6199:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6228:Wdfy3	UTSW	5	101898429	missense	possibly damaging	0.67
R6258:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6259:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6298:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R6479:Wdfy3	UTSW	5	101913179	missense	probably damaging	1.00
R6550:Wdfy3	UTSW	5	101953166	missense	probably benign	0.19
R6776:Wdfy3	UTSW	5	101884045	missense	possibly damaging	0.57
R6793:Wdfy3	UTSW	5	101917431	nonsense	probably null
R6809:Wdfy3	UTSW	5	101923947	missense	possibly damaging	0.63
R6836:Wdfy3	UTSW	5	101952999	missense	probably damaging	1.00
R6897:Wdfy3	UTSW	5	101844066	missense	probably benign	0.10
R7014:Wdfy3	UTSW	5	101894909	critical splice donor site	probably null
R7034:Wdfy3	UTSW	5	101907518	missense	probably damaging	1.00
R7035:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R7135:Wdfy3	UTSW	5	101915437	missense	probably damaging	1.00
R7182:Wdfy3	UTSW	5	101943892	missense	possibly damaging	0.51
R7217:Wdfy3	UTSW	5	101901919	missense	probably damaging	1.00
R7236:Wdfy3	UTSW	5	101836208	missense	probably damaging	0.99
R7264:Wdfy3	UTSW	5	101855523	missense	probably benign	0.02
R7418:Wdfy3	UTSW	5	101957500	missense	probably benign	0.08
R7533:Wdfy3	UTSW	5	101882488	missense	probably benign	0.27
R7543:Wdfy3	UTSW	5	101936059	missense	probably benign	0.00
R7625:Wdfy3	UTSW	5	101855386	splice site	probably null
R7788:Wdfy3	UTSW	5	101848357	missense	probably damaging	0.99
R7810:Wdfy3	UTSW	5	101895074	missense	probably benign	0.01
R7810:Wdfy3	UTSW	5	101951399	nonsense	probably null
R8204:Wdfy3	UTSW	5	101852585	missense	probably benign	0.00
R8268:Wdfy3	UTSW	5	101941610	missense	probably damaging	1.00
R8286:Wdfy3	UTSW	5	101937421	missense	probably benign
R8507:Wdfy3	UTSW	5	101872901	missense	probably benign	0.05
R8514:Wdfy3	UTSW	5	101851353	missense	possibly damaging	0.92
R8536:Wdfy3	UTSW	5	101885198	missense	probably benign
R8710:Wdfy3	UTSW	5	101882483	missense	probably damaging	1.00
R8735:Wdfy3	UTSW	5	101930085	missense	probably benign	0.00
R8749:Wdfy3	UTSW	5	101882580	missense	probably damaging	1.00
R8931:Wdfy3	UTSW	5	101917555	missense	probably benign	0.11
R8943:Wdfy3	UTSW	5	101845365	intron	probably benign
R8968:Wdfy3	UTSW	5	101864117	missense	probably benign	0.05
R8979:Wdfy3	UTSW	5	101948898	missense	probably damaging	1.00
R8998:Wdfy3	UTSW	5	101845192	missense	probably benign	0.05
R9045:Wdfy3	UTSW	5	101847174	missense	probably damaging	1.00
R9068:Wdfy3	UTSW	5	101852585	missense	probably benign	0.34
R9105:Wdfy3	UTSW	5	101882646	missense	probably benign	0.05
R9122:Wdfy3	UTSW	5	101943965	missense	probably damaging	1.00
R9209:Wdfy3	UTSW	5	101930964	missense	probably benign	0.01
R9249:Wdfy3	UTSW	5	101848493	missense	possibly damaging	0.82
R9348:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R9481:Wdfy3	UTSW	5	101852612	missense	probably benign	0.19
R9490:Wdfy3	UTSW	5	101930850	missense	probably benign	0.29
R9524:Wdfy3	UTSW	5	101907467	missense	probably benign	0.03
R9545:Wdfy3	UTSW	5	101953091	missense
R9548:Wdfy3	UTSW	5	101885193	missense	probably damaging	0.99
R9636:Wdfy3	UTSW	5	101900033	missense	probably benign
R9750:Wdfy3	UTSW	5	101930094	missense	probably benign	0.00
R9766:Wdfy3	UTSW	5	101895000	missense	possibly damaging	0.90
R9771:Wdfy3	UTSW	5	101852329	missense	probably damaging	1.00
Z1177:Wdfy3	UTSW	5	101900241	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- GTGCTGTCTCTACCTGGAACATTTCAC -3'
(R):5'- GGGCTGGTTTCATCCTTCTGACATAG -3'

Sequencing Primer
(F):5'- CTGGAACATTTCACATGTCTATCAGC -3'
(R):5'- CATCCTTCTGACATAGTTTACAGTG -3'

Posted On

2013-06-12