Mutagenetix > Incidental Mutations

Incidental Mutation 'R6013:Abca17'

479877

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

MMRRC Submission

044189-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6013 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24287846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1178 (V1178E)

Ref Sequence

ENSEMBL: ENSMUSP00000112538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

AlphaFold

E9PX95

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039324
AA Change: V1178E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V1178E

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121226
AA Change: V1178E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V1178E

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008P02Rik	C	T	3: 6,617,250		probably null	Het
Aanat	A	T	11: 116,596,124		probably null	Het
Abcf3	T	A	16: 20,550,561		probably null	Het
Alk	A	G	17: 71,900,737	M1001T	probably benign	Het
Arhgap23	C	A	11: 97,500,992	S1445Y	probably damaging	Het
Atp10a	T	C	7: 58,797,790	I760T	probably benign	Het
BC030867	T	C	11: 102,255,033	V45A	probably benign	Het
Cadm1	C	T	9: 47,857,274		probably benign	Het
Car10	A	T	11: 93,185,279		probably benign	Het
Casq2	G	T	3: 102,145,629		probably null	Het
Clec4f	T	C	6: 83,655,088	I55V	probably benign	Het
Cngb1	T	C	8: 95,284,321		probably benign	Het
Csn1s2b	A	G	5: 87,824,239		probably null	Het
Cyp2c39	A	C	19: 39,513,525	R119S	probably benign	Het
Cyp4f16	C	T	17: 32,546,678	A345V	probably null	Het
Ddx43	T	C	9: 78,414,285	L412S	probably damaging	Het
Dnajb12	G	A	10: 59,894,341		probably null	Het
Ephx2	A	G	14: 66,110,242	S56P	probably benign	Het
Fam83h	A	G	15: 76,004,000	F496S	probably damaging	Het
Gcnt4	T	C	13: 96,947,278	S361P	possibly damaging	Het
H2-T23	G	T	17: 36,030,582	H332Q	probably benign	Het
Ift57	G	T	16: 49,699,304		probably null	Het
Il1rl2	A	G	1: 40,351,857	H320R	possibly damaging	Het
Kansl1	A	G	11: 104,350,639	V618A	probably benign	Het
Kctd3	T	C	1: 188,996,468	E157G	probably benign	Het
Magohb	T	A	6: 131,293,074	D31V	possibly damaging	Het
Mdn1	C	A	4: 32,715,713	F1993L	probably damaging	Het
Med29	C	A	7: 28,386,993	C130F	probably benign	Het
Mtmr7	G	A	8: 40,581,528	R251C	probably damaging	Het
Ncor1	T	C	11: 62,321,077	I49V	probably benign	Het
Nfkb1	G	T	3: 135,626,684	T109K	possibly damaging	Het
Pkd1l1	A	G	11: 8,869,452		probably null	Het
Pkp1	T	A	1: 135,883,910	T408S	probably damaging	Het
Plec	A	T	15: 76,189,310	D501E	possibly damaging	Het
Ppil2	T	C	16: 17,100,265	N96D	probably damaging	Het
Prcp	A	C	7: 92,927,768	Y335S	possibly damaging	Het
Reg2	T	A	6: 78,407,969	Y165N	possibly damaging	Het
Rnf7	T	C	9: 96,471,734	*114W	probably null	Het
Scg3	T	C	9: 75,676,808	D137G	probably damaging	Het
Serpinb7	T	C	1: 107,450,189	V204A	probably benign	Het
Sez6	C	T	11: 77,973,797	H528Y	probably damaging	Het
Sf3b1	A	T	1: 55,000,298	S723T	probably damaging	Het
Shtn1	T	C	19: 58,975,101	D594G	probably damaging	Het
Sptbn4	A	G	7: 27,364,479	L2174P	probably damaging	Het
Stk25	A	G	1: 93,625,459		probably null	Het
Tep1	A	T	14: 50,861,048	F429I	probably damaging	Het
Thada	T	A	17: 84,272,800	I1409F	probably benign	Het
Tmem2	G	A	19: 21,832,039	V928I	possibly damaging	Het
Usp25	G	A	16: 77,077,021	G495E	probably benign	Het
Washc2	A	G	6: 116,254,153	S844G	probably damaging	Het
Xirp2	A	T	2: 67,510,943	H1176L	possibly damaging	Het
Zfand6	C	A	7: 84,632,692	V110L	probably benign	Het
Zfp30	A	G	7: 29,789,421	R8G	possibly damaging	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
basin	UTSW	17	24318185	missense	probably benign	0.01
Bowl	UTSW	17	24317238	missense	probably benign	0.09
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1696:Abca17	UTSW	17	24267658	missense	possibly damaging	0.90
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R1997:Abca17	UTSW	17	24285726	missense	probably benign	0.02
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2509:Abca17	UTSW	17	24289613	splice site	probably benign
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3695:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6746:Abca17	UTSW	17	24346221	nonsense	probably null
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R7915:Abca17	UTSW	17	24265533	missense	probably damaging	1.00
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
R8095:Abca17	UTSW	17	24317222	missense	possibly damaging	0.77
R8308:Abca17	UTSW	17	24267683	missense	probably damaging	1.00
R8517:Abca17	UTSW	17	24317233	missense	probably benign	0.00
R8811:Abca17	UTSW	17	24317238	missense	probably benign	0.09
R8819:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8820:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8953:Abca17	UTSW	17	24299041	missense	probably benign
R9095:Abca17	UTSW	17	24281396	missense	probably damaging	0.97
R9313:Abca17	UTSW	17	24346233	missense	probably benign	0.00
R9314:Abca17	UTSW	17	24328619	missense	possibly damaging	0.91
R9347:Abca17	UTSW	17	24264505	missense	probably benign
R9351:Abca17	UTSW	17	24291777	missense	probably benign	0.00
R9387:Abca17	UTSW	17	24334281	missense	probably benign	0.02
R9388:Abca17	UTSW	17	24264299	missense	unknown
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTGAGTTGTTTGTCCACCCTG -3'
(R):5'- CGCTATATTCTTAGCACTCAGGATG -3'

Sequencing Primer
(F):5'- GCTGCGAGCGCTATCTCTTG -3'
(R):5'- AGGATGAACCCTTACGGACTCTTC -3'

Posted On

2017-06-26