Incidental Mutation 'R6013:Thada'
ID479881
Institutional Source Beutler Lab
Gene Symbol Thada
Ensembl Gene ENSMUSG00000024251
Gene Namethyroid adenoma associated
Synonyms
MMRRC Submission 044189-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6013 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location84190056-84466196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84272800 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1409 (I1409F)
Ref Sequence ENSEMBL: ENSMUSP00000041701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047524]
Predicted Effect probably benign
Transcript: ENSMUST00000047524
AA Change: I1409F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041701
Gene: ENSMUSG00000024251
AA Change: I1409F

DomainStartEndE-ValueType
SCOP:d1gw5a_ 457 926 3e-6 SMART
Pfam:DUF2428 938 1239 1.6e-93 PFAM
SCOP:d1gw5a_ 1343 1802 7e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the target of 2p21 choromosomal aberrations in benign thyroid adenomas. Single nucleotide polymorphisms (SNPs) in this gene may be associated with type 2 diabetes and polycystic ovary syndrome. The encoded protein is likely involved in the death receptor pathway and apoptosis. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008P02Rik C T 3: 6,617,250 probably null Het
Aanat A T 11: 116,596,124 probably null Het
Abca17 A T 17: 24,287,846 V1178E possibly damaging Het
Abcf3 T A 16: 20,550,561 probably null Het
Alk A G 17: 71,900,737 M1001T probably benign Het
Arhgap23 C A 11: 97,500,992 S1445Y probably damaging Het
Atp10a T C 7: 58,797,790 I760T probably benign Het
BC030867 T C 11: 102,255,033 V45A probably benign Het
Cadm1 C T 9: 47,857,274 probably benign Het
Car10 A T 11: 93,185,279 probably benign Het
Casq2 G T 3: 102,145,629 probably null Het
Clec4f T C 6: 83,655,088 I55V probably benign Het
Cngb1 T C 8: 95,284,321 probably benign Het
Csn1s2b A G 5: 87,824,239 probably null Het
Cyp2c39 A C 19: 39,513,525 R119S probably benign Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Ddx43 T C 9: 78,414,285 L412S probably damaging Het
Dnajb12 G A 10: 59,894,341 probably null Het
Ephx2 A G 14: 66,110,242 S56P probably benign Het
Fam83h A G 15: 76,004,000 F496S probably damaging Het
Gcnt4 T C 13: 96,947,278 S361P possibly damaging Het
H2-T23 G T 17: 36,030,582 H332Q probably benign Het
Ift57 G T 16: 49,699,304 probably null Het
Il1rl2 A G 1: 40,351,857 H320R possibly damaging Het
Kansl1 A G 11: 104,350,639 V618A probably benign Het
Kctd3 T C 1: 188,996,468 E157G probably benign Het
Magohb T A 6: 131,293,074 D31V possibly damaging Het
Mdn1 C A 4: 32,715,713 F1993L probably damaging Het
Med29 C A 7: 28,386,993 C130F probably benign Het
Mtmr7 G A 8: 40,581,528 R251C probably damaging Het
Ncor1 T C 11: 62,321,077 I49V probably benign Het
Nfkb1 G T 3: 135,626,684 T109K possibly damaging Het
Pkd1l1 A G 11: 8,869,452 probably null Het
Pkp1 T A 1: 135,883,910 T408S probably damaging Het
Plec A T 15: 76,189,310 D501E possibly damaging Het
Ppil2 T C 16: 17,100,265 N96D probably damaging Het
Prcp A C 7: 92,927,768 Y335S possibly damaging Het
Reg2 T A 6: 78,407,969 Y165N possibly damaging Het
Rnf7 T C 9: 96,471,734 *114W probably null Het
Scg3 T C 9: 75,676,808 D137G probably damaging Het
Serpinb7 T C 1: 107,450,189 V204A probably benign Het
Sez6 C T 11: 77,973,797 H528Y probably damaging Het
Sf3b1 A T 1: 55,000,298 S723T probably damaging Het
Shtn1 T C 19: 58,975,101 D594G probably damaging Het
Sptbn4 A G 7: 27,364,479 L2174P probably damaging Het
Stk25 A G 1: 93,625,459 probably null Het
Tep1 A T 14: 50,861,048 F429I probably damaging Het
Tmem2 G A 19: 21,832,039 V928I possibly damaging Het
Usp25 G A 16: 77,077,021 G495E probably benign Het
Washc2 A G 6: 116,254,153 S844G probably damaging Het
Xirp2 A T 2: 67,510,943 H1176L possibly damaging Het
Zfand6 C A 7: 84,632,692 V110L probably benign Het
Zfp30 A G 7: 29,789,421 R8G possibly damaging Het
Other mutations in Thada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Thada APN 17 84444218 missense probably benign 0.01
IGL00902:Thada APN 17 84447976 missense probably damaging 1.00
IGL01634:Thada APN 17 84393358 critical splice donor site probably null
IGL01689:Thada APN 17 84446688 missense possibly damaging 0.80
IGL01693:Thada APN 17 84446644 missense probably benign
IGL01937:Thada APN 17 84222766 missense probably benign 0.00
IGL01945:Thada APN 17 84222766 missense probably benign 0.00
IGL02231:Thada APN 17 84428697 missense probably damaging 1.00
IGL02951:Thada APN 17 84444028 missense probably benign 0.16
IGL03167:Thada APN 17 84458849 missense probably damaging 0.97
IGL03279:Thada APN 17 84435560 missense probably benign 0.01
IGL03347:Thada APN 17 84398205 missense probably damaging 1.00
H8562:Thada UTSW 17 84446544 missense probably damaging 1.00
IGL03098:Thada UTSW 17 84334141 missense possibly damaging 0.93
R0006:Thada UTSW 17 84226040 missense probably benign 0.00
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0052:Thada UTSW 17 84455158 missense probably damaging 0.99
R0357:Thada UTSW 17 84230936 missense probably damaging 1.00
R0388:Thada UTSW 17 84231096 missense probably benign 0.00
R0543:Thada UTSW 17 84423163 missense probably damaging 1.00
R0606:Thada UTSW 17 84416303 missense possibly damaging 0.90
R0630:Thada UTSW 17 84229175 missense probably damaging 1.00
R0664:Thada UTSW 17 84336829 missense probably damaging 1.00
R0855:Thada UTSW 17 84436655 missense probably damaging 1.00
R0972:Thada UTSW 17 84429062 splice site probably benign
R1297:Thada UTSW 17 84252435 splice site probably benign
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1465:Thada UTSW 17 84436676 missense possibly damaging 0.92
R1490:Thada UTSW 17 84446601 missense possibly damaging 0.68
R1789:Thada UTSW 17 84448033 missense probably damaging 1.00
R1789:Thada UTSW 17 84448034 missense probably damaging 1.00
R1802:Thada UTSW 17 84464407 missense probably benign 0.34
R1831:Thada UTSW 17 84231114 missense probably damaging 0.97
R1834:Thada UTSW 17 84226004 missense possibly damaging 0.53
R1881:Thada UTSW 17 84436702 missense probably benign 0.19
R1925:Thada UTSW 17 84444499 missense probably benign 0.05
R1969:Thada UTSW 17 84310042 missense probably damaging 1.00
R1970:Thada UTSW 17 84310042 missense probably damaging 1.00
R1971:Thada UTSW 17 84310042 missense probably damaging 1.00
R2149:Thada UTSW 17 84441764 missense probably damaging 1.00
R2191:Thada UTSW 17 84446521 missense probably benign 0.00
R2571:Thada UTSW 17 84454640 missense probably damaging 0.99
R3405:Thada UTSW 17 84230785 splice site probably benign
R3406:Thada UTSW 17 84230785 splice site probably benign
R3916:Thada UTSW 17 84441782 missense possibly damaging 0.92
R4044:Thada UTSW 17 84441707 missense probably benign 0.41
R4461:Thada UTSW 17 84426237 missense probably damaging 1.00
R4662:Thada UTSW 17 84435650 missense probably damaging 1.00
R4696:Thada UTSW 17 84426186 missense possibly damaging 0.83
R4786:Thada UTSW 17 84458855 missense possibly damaging 0.66
R4803:Thada UTSW 17 84272817 missense probably damaging 0.96
R4835:Thada UTSW 17 84441104 splice site probably null
R4872:Thada UTSW 17 84446599 missense probably damaging 1.00
R4898:Thada UTSW 17 84448042 splice site probably null
R4903:Thada UTSW 17 84252400 missense possibly damaging 0.67
R4929:Thada UTSW 17 84444226 missense probably benign 0.01
R4959:Thada UTSW 17 84444183 missense probably damaging 1.00
R5071:Thada UTSW 17 84386532 missense probably damaging 1.00
R5092:Thada UTSW 17 84444468 missense probably damaging 0.97
R5398:Thada UTSW 17 84426186 missense probably benign 0.03
R5480:Thada UTSW 17 84432254 missense probably benign 0.00
R5552:Thada UTSW 17 84429130 missense probably benign 0.03
R5575:Thada UTSW 17 84416399 splice site probably null
R5623:Thada UTSW 17 84191983 missense probably benign 0.00
R5688:Thada UTSW 17 84451727 missense probably benign 0.00
R5704:Thada UTSW 17 84230901 missense probably benign 0.01
R6008:Thada UTSW 17 84436634 missense probably damaging 1.00
R6072:Thada UTSW 17 84192006 missense possibly damaging 0.93
R6156:Thada UTSW 17 84393367 missense probably damaging 0.98
R6243:Thada UTSW 17 84436602 missense probably benign 0.01
R6449:Thada UTSW 17 84429173 missense probably benign
R6453:Thada UTSW 17 84416323 missense probably damaging 1.00
R6474:Thada UTSW 17 84443911 missense possibly damaging 0.83
R6732:Thada UTSW 17 84454414 intron probably null
R6907:Thada UTSW 17 84393469 missense probably damaging 1.00
R7117:Thada UTSW 17 84230786 splice site probably null
R7167:Thada UTSW 17 84230963 missense probably benign
R7221:Thada UTSW 17 84464366 missense possibly damaging 0.46
R7470:Thada UTSW 17 84226041 missense probably benign
R7753:Thada UTSW 17 84252390 missense probably damaging 1.00
R7809:Thada UTSW 17 84451837 missense possibly damaging 0.80
R7882:Thada UTSW 17 84429196 missense possibly damaging 0.85
R7965:Thada UTSW 17 84429196 missense possibly damaging 0.85
R8004:Thada UTSW 17 84192205 missense probably benign
Z1176:Thada UTSW 17 84444430 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTCTGGAAACGACTGAAACCTC -3'
(R):5'- ACGGTGATCCTTGGTCTAGG -3'

Sequencing Primer
(F):5'- GACTGAAACCTCCTCACAACTTG -3'
(R):5'- CTAGGGAATTGTGGGAGTGACC -3'
Posted On2017-06-26