Incidental Mutation 'R6014:Lemd1'
ID479889
Institutional Source Beutler Lab
Gene Symbol Lemd1
Ensembl Gene ENSMUSG00000079330
Gene NameLEM domain containing 1
SynonymsLEMP-1, 6430514M23Rik, 4930540I23Rik
MMRRC Submission 044190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6014 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132191431-132259227 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 132256725 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Serine at position 102 (*102S)
Ref Sequence ENSEMBL: ENSMUSP00000140524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112357] [ENSMUST00000185436] [ENSMUST00000187339] [ENSMUST00000188169] [ENSMUST00000191418]
Predicted Effect probably benign
Transcript: ENSMUST00000112357
AA Change: L78F

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107976
Gene: ENSMUSG00000079330
AA Change: L78F

DomainStartEndE-ValueType
Pfam:LEM 3 42 9.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185436
SMART Domains Protein: ENSMUSP00000140418
Gene: ENSMUSG00000079330

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187339
SMART Domains Protein: ENSMUSP00000139708
Gene: ENSMUSG00000079330

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188169
AA Change: *102S
SMART Domains Protein: ENSMUSP00000140524
Gene: ENSMUSG00000079330
AA Change: *102S

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
low complexity region 81 100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191418
AA Change: K127Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140193
Gene: ENSMUSG00000079330
AA Change: K127Q

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
low complexity region 81 92 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A T 2: 35,354,869 M157K probably benign Het
A2ml1 C T 6: 128,571,985 C278Y probably damaging Het
Abcc2 A T 19: 43,826,735 Q1187L probably benign Het
Adcy9 A T 16: 4,418,819 Y6N probably damaging Het
Adh1 T C 3: 138,286,798 I225T probably benign Het
Akap11 A T 14: 78,512,499 I816K probably benign Het
Ap1b1 T A 11: 5,019,364 M240K possibly damaging Het
Apex1 A T 14: 50,925,525 T17S probably benign Het
Arhgap21 C T 2: 20,881,805 G26D probably damaging Het
Bahcc1 A G 11: 120,289,789 Y2613C probably benign Het
Baz1b C T 5: 135,217,394 R566W probably damaging Het
Casp8ap2 A T 4: 32,641,400 Y818F probably damaging Het
Col3a1 T A 1: 45,321,579 C56* probably null Het
Coro2a G A 4: 46,542,261 P371S probably damaging Het
Cyp2a22 T A 7: 26,939,180 probably null Het
Dpysl3 T A 18: 43,361,067 I183F probably damaging Het
Drc1 A T 5: 30,345,649 N172I probably damaging Het
Dst T C 1: 34,264,834 Y1378H probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l3 A T 17: 69,283,960 T91S probably damaging Het
Exoc4 T C 6: 33,475,997 V474A probably benign Het
Fam229b G A 10: 39,118,993 T56I probably damaging Het
Gfm2 A G 13: 97,151,661 probably null Het
Git2 C T 5: 114,733,877 E152K probably benign Het
Golt1b T A 6: 142,396,217 I109N probably damaging Het
Grid2ip T A 5: 143,387,823 M783K possibly damaging Het
Inpp5a A G 7: 139,574,982 Y339C probably damaging Het
Isoc2a T C 7: 4,891,626 S103P probably damaging Het
Itih4 C A 14: 30,892,629 Q483K probably benign Het
Kansl2 A G 15: 98,520,316 probably null Het
Kdm5d G A Y: 921,528 A509T probably benign Het
Krt13 A T 11: 100,117,611 D433E unknown Het
Lat2 C T 5: 134,603,454 V142M probably damaging Het
Lrfn2 T C 17: 49,069,906 L5P possibly damaging Het
Lrrc4c T G 2: 97,629,212 probably null Het
Lypla1 T A 1: 4,808,371 probably null Het
Magi2 G A 5: 20,611,093 G744R probably damaging Het
Myh14 T A 7: 44,625,078 E948V probably null Het
Myo5a C A 9: 75,167,207 Y799* probably null Het
Nacc1 A C 8: 84,675,071 M371R possibly damaging Het
Nlrp5 T G 7: 23,409,947 M106R probably benign Het
Oas1h C T 5: 120,867,166 H226Y possibly damaging Het
Obscn A C 11: 59,038,864 I5175R probably damaging Het
Pcdh7 T A 5: 57,721,155 I684N probably damaging Het
Pcdhb3 T A 18: 37,302,653 N557K probably damaging Het
Pde3b T C 7: 114,416,440 L297S probably damaging Het
Pigv G T 4: 133,665,429 H143Q probably benign Het
Ptk2 T G 15: 73,304,444 Y251S possibly damaging Het
Ralgds A G 2: 28,543,661 N219S probably damaging Het
Sardh C A 2: 27,197,528 probably null Het
Serpina3b A T 12: 104,131,097 K212N possibly damaging Het
Sh3bp2 A G 5: 34,559,627 N461D probably benign Het
Shisa2 A T 14: 59,629,908 Q203L probably damaging Het
Shmt1 C A 11: 60,797,557 G255V probably damaging Het
Socs1 T A 16: 10,784,493 I127F possibly damaging Het
Srcap A T 7: 127,538,750 T1091S probably benign Het
Syt14 A G 1: 192,930,695 I599T probably damaging Het
Tep1 A T 14: 50,847,000 N907K probably benign Het
Themis2 A G 4: 132,785,980 Y312H probably benign Het
Tubgcp5 T G 7: 55,823,609 S812A probably benign Het
Ush2a A T 1: 188,850,040 I3767F probably damaging Het
Usp40 T A 1: 87,980,016 E626V probably damaging Het
Utrn T C 10: 12,690,876 R1181G probably benign Het
Vmn2r117 T A 17: 23,479,561 I13F probably damaging Het
Wdr34 C T 2: 30,031,751 A533T probably benign Het
Wdr48 G T 9: 119,924,709 V646F probably damaging Het
Wdr64 T C 1: 175,805,990 F936L possibly damaging Het
Other mutations in Lemd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Lemd1 APN 1 132256709 missense probably benign 0.00
R1742:Lemd1 UTSW 1 132228298 missense probably damaging 1.00
R2212:Lemd1 UTSW 1 132228286 missense probably benign 0.11
R6009:Lemd1 UTSW 1 132228252 nonsense probably null
R7163:Lemd1 UTSW 1 132256737 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAATACTCCGCAGCACTGAG -3'
(R):5'- AACCCAAGAGTGGCTTCTTTTC -3'

Sequencing Primer
(F):5'- GCAGCACTGAGACCCCTC -3'
(R):5'- GGCTTCTTTTCCACAATTATGTAGAC -3'
Posted On2017-06-26