Incidental Mutation 'R6014:Lat2'
ID479909
Institutional Source Beutler Lab
Gene Symbol Lat2
Ensembl Gene ENSMUSG00000040751
Gene Namelinker for activation of T cells family, member 2
SynonymsWbscr15, Wbscr5
MMRRC Submission 044190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6014 (G1)
Quality Score172.009
Status Validated
Chromosome5
Chromosomal Location134600022-134615025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134603454 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 142 (V142M)
Ref Sequence ENSEMBL: ENSMUSP00000143977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023867] [ENSMUST00000036362] [ENSMUST00000077636] [ENSMUST00000200737] [ENSMUST00000200998] [ENSMUST00000202085]
Predicted Effect probably benign
Transcript: ENSMUST00000023867
SMART Domains Protein: ENSMUSP00000023867
Gene: ENSMUSG00000023104

DomainStartEndE-ValueType
AAA 63 189 9.42e-13 SMART
Pfam:Rep_fac_C 253 338 3.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036362
AA Change: V142M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046900
Gene: ENSMUSG00000040751
AA Change: V142M

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:LAT2 29 197 6.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077636
AA Change: V130M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076824
Gene: ENSMUSG00000040751
AA Change: V130M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200737
AA Change: C104Y

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143998
Gene: ENSMUSG00000040751
AA Change: C104Y

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:LAT2 29 114 9.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200945
Predicted Effect probably damaging
Transcript: ENSMUST00000200998
AA Change: V142M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143977
Gene: ENSMUSG00000040751
AA Change: V142M

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:LAT2 29 197 6.6e-82 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000201632
AA Change: V39M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201832
Predicted Effect probably benign
Transcript: ENSMUST00000202085
SMART Domains Protein: ENSMUSP00000144611
Gene: ENSMUSG00000040751

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:LAT2 29 116 7.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202746
Meta Mutation Damage Score 0.2868 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal mast cell physiology and increased anti-nuclear antigen antibody level. Mice homozygous for another null allele show abnormal mast cell physiology, hyperactivated T cells, higher cytokine production, spleenhyperplasia and increased autoantibody level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A T 2: 35,354,869 M157K probably benign Het
A2ml1 C T 6: 128,571,985 C278Y probably damaging Het
Abcc2 A T 19: 43,826,735 Q1187L probably benign Het
Adcy9 A T 16: 4,418,819 Y6N probably damaging Het
Adh1 T C 3: 138,286,798 I225T probably benign Het
Akap11 A T 14: 78,512,499 I816K probably benign Het
Ap1b1 T A 11: 5,019,364 M240K possibly damaging Het
Apex1 A T 14: 50,925,525 T17S probably benign Het
Arhgap21 C T 2: 20,881,805 G26D probably damaging Het
Bahcc1 A G 11: 120,289,789 Y2613C probably benign Het
Baz1b C T 5: 135,217,394 R566W probably damaging Het
Casp8ap2 A T 4: 32,641,400 Y818F probably damaging Het
Col3a1 T A 1: 45,321,579 C56* probably null Het
Coro2a G A 4: 46,542,261 P371S probably damaging Het
Cyp2a22 T A 7: 26,939,180 probably null Het
Dpysl3 T A 18: 43,361,067 I183F probably damaging Het
Drc1 A T 5: 30,345,649 N172I probably damaging Het
Dst T C 1: 34,264,834 Y1378H probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l3 A T 17: 69,283,960 T91S probably damaging Het
Exoc4 T C 6: 33,475,997 V474A probably benign Het
Fam229b G A 10: 39,118,993 T56I probably damaging Het
Gfm2 A G 13: 97,151,661 probably null Het
Git2 C T 5: 114,733,877 E152K probably benign Het
Golt1b T A 6: 142,396,217 I109N probably damaging Het
Grid2ip T A 5: 143,387,823 M783K possibly damaging Het
Inpp5a A G 7: 139,574,982 Y339C probably damaging Het
Isoc2a T C 7: 4,891,626 S103P probably damaging Het
Itih4 C A 14: 30,892,629 Q483K probably benign Het
Kansl2 A G 15: 98,520,316 probably null Het
Kdm5d G A Y: 921,528 A509T probably benign Het
Krt13 A T 11: 100,117,611 D433E unknown Het
Lemd1 A C 1: 132,256,725 *102S probably null Het
Lrfn2 T C 17: 49,069,906 L5P possibly damaging Het
Lrrc4c T G 2: 97,629,212 probably null Het
Lypla1 T A 1: 4,808,371 probably null Het
Magi2 G A 5: 20,611,093 G744R probably damaging Het
Myh14 T A 7: 44,625,078 E948V probably null Het
Myo5a C A 9: 75,167,207 Y799* probably null Het
Nacc1 A C 8: 84,675,071 M371R possibly damaging Het
Nlrp5 T G 7: 23,409,947 M106R probably benign Het
Oas1h C T 5: 120,867,166 H226Y possibly damaging Het
Obscn A C 11: 59,038,864 I5175R probably damaging Het
Pcdh7 T A 5: 57,721,155 I684N probably damaging Het
Pcdhb3 T A 18: 37,302,653 N557K probably damaging Het
Pde3b T C 7: 114,416,440 L297S probably damaging Het
Pigv G T 4: 133,665,429 H143Q probably benign Het
Ptk2 T G 15: 73,304,444 Y251S possibly damaging Het
Ralgds A G 2: 28,543,661 N219S probably damaging Het
Sardh C A 2: 27,197,528 probably null Het
Serpina3b A T 12: 104,131,097 K212N possibly damaging Het
Sh3bp2 A G 5: 34,559,627 N461D probably benign Het
Shisa2 A T 14: 59,629,908 Q203L probably damaging Het
Shmt1 C A 11: 60,797,557 G255V probably damaging Het
Socs1 T A 16: 10,784,493 I127F possibly damaging Het
Srcap A T 7: 127,538,750 T1091S probably benign Het
Syt14 A G 1: 192,930,695 I599T probably damaging Het
Tep1 A T 14: 50,847,000 N907K probably benign Het
Themis2 A G 4: 132,785,980 Y312H probably benign Het
Tubgcp5 T G 7: 55,823,609 S812A probably benign Het
Ush2a A T 1: 188,850,040 I3767F probably damaging Het
Usp40 T A 1: 87,980,016 E626V probably damaging Het
Utrn T C 10: 12,690,876 R1181G probably benign Het
Vmn2r117 T A 17: 23,479,561 I13F probably damaging Het
Wdr34 C T 2: 30,031,751 A533T probably benign Het
Wdr48 G T 9: 119,924,709 V646F probably damaging Het
Wdr64 T C 1: 175,805,990 F936L possibly damaging Het
Other mutations in Lat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Lat2 APN 5 134606776 critical splice donor site probably null
IGL01897:Lat2 APN 5 134606627 splice site probably benign
IGL02869:Lat2 APN 5 134608173 missense probably damaging 1.00
IGL03018:Lat2 APN 5 134602591 missense probably damaging 0.97
R0735:Lat2 UTSW 5 134606783 missense probably damaging 1.00
R1739:Lat2 UTSW 5 134606369 missense possibly damaging 0.93
R2257:Lat2 UTSW 5 134602627 missense probably damaging 1.00
R2866:Lat2 UTSW 5 134605944 missense probably damaging 0.99
R4675:Lat2 UTSW 5 134606057 missense probably damaging 0.99
R5008:Lat2 UTSW 5 134603137 missense probably benign 0.02
R6422:Lat2 UTSW 5 134603161 missense probably benign 0.00
R7330:Lat2 UTSW 5 134606787 missense probably damaging 0.99
R7512:Lat2 UTSW 5 134605944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCAGGACCTTGGGTGAAC -3'
(R):5'- TGTACACCTATACCCGCAGTC -3'

Sequencing Primer
(F):5'- TCAGGACCTTGGGTGAACTTAACC -3'
(R):5'- GCTCAGTAGTTAAGAGCACCTACTG -3'
Posted On2017-06-26