Incidental Mutation 'R6014:Tep1'
ID479935
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Nametelomerase associated protein 1
SynonymsTp1
MMRRC Submission 044190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6014 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50824059-50870560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50847000 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 907 (N907K)
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444]
Predicted Effect probably benign
Transcript: ENSMUST00000006444
AA Change: N907K

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: N907K

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000226430
AA Change: N182K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226789
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A T 2: 35,354,869 M157K probably benign Het
A2ml1 C T 6: 128,571,985 C278Y probably damaging Het
Abcc2 A T 19: 43,826,735 Q1187L probably benign Het
Adcy9 A T 16: 4,418,819 Y6N probably damaging Het
Adh1 T C 3: 138,286,798 I225T probably benign Het
Akap11 A T 14: 78,512,499 I816K probably benign Het
Ap1b1 T A 11: 5,019,364 M240K possibly damaging Het
Apex1 A T 14: 50,925,525 T17S probably benign Het
Arhgap21 C T 2: 20,881,805 G26D probably damaging Het
Bahcc1 A G 11: 120,289,789 Y2613C probably benign Het
Baz1b C T 5: 135,217,394 R566W probably damaging Het
Casp8ap2 A T 4: 32,641,400 Y818F probably damaging Het
Col3a1 T A 1: 45,321,579 C56* probably null Het
Coro2a G A 4: 46,542,261 P371S probably damaging Het
Cyp2a22 T A 7: 26,939,180 probably null Het
Dpysl3 T A 18: 43,361,067 I183F probably damaging Het
Drc1 A T 5: 30,345,649 N172I probably damaging Het
Dst T C 1: 34,264,834 Y1378H probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l3 A T 17: 69,283,960 T91S probably damaging Het
Exoc4 T C 6: 33,475,997 V474A probably benign Het
Fam229b G A 10: 39,118,993 T56I probably damaging Het
Gfm2 A G 13: 97,151,661 probably null Het
Git2 C T 5: 114,733,877 E152K probably benign Het
Golt1b T A 6: 142,396,217 I109N probably damaging Het
Grid2ip T A 5: 143,387,823 M783K possibly damaging Het
Inpp5a A G 7: 139,574,982 Y339C probably damaging Het
Isoc2a T C 7: 4,891,626 S103P probably damaging Het
Itih4 C A 14: 30,892,629 Q483K probably benign Het
Kansl2 A G 15: 98,520,316 probably null Het
Kdm5d G A Y: 921,528 A509T probably benign Het
Krt13 A T 11: 100,117,611 D433E unknown Het
Lat2 C T 5: 134,603,454 V142M probably damaging Het
Lemd1 A C 1: 132,256,725 *102S probably null Het
Lrfn2 T C 17: 49,069,906 L5P possibly damaging Het
Lrrc4c T G 2: 97,629,212 probably null Het
Lypla1 T A 1: 4,808,371 probably null Het
Magi2 G A 5: 20,611,093 G744R probably damaging Het
Myh14 T A 7: 44,625,078 E948V probably null Het
Myo5a C A 9: 75,167,207 Y799* probably null Het
Nacc1 A C 8: 84,675,071 M371R possibly damaging Het
Nlrp5 T G 7: 23,409,947 M106R probably benign Het
Oas1h C T 5: 120,867,166 H226Y possibly damaging Het
Obscn A C 11: 59,038,864 I5175R probably damaging Het
Pcdh7 T A 5: 57,721,155 I684N probably damaging Het
Pcdhb3 T A 18: 37,302,653 N557K probably damaging Het
Pde3b T C 7: 114,416,440 L297S probably damaging Het
Pigv G T 4: 133,665,429 H143Q probably benign Het
Ptk2 T G 15: 73,304,444 Y251S possibly damaging Het
Ralgds A G 2: 28,543,661 N219S probably damaging Het
Sardh C A 2: 27,197,528 probably null Het
Serpina3b A T 12: 104,131,097 K212N possibly damaging Het
Sh3bp2 A G 5: 34,559,627 N461D probably benign Het
Shisa2 A T 14: 59,629,908 Q203L probably damaging Het
Shmt1 C A 11: 60,797,557 G255V probably damaging Het
Socs1 T A 16: 10,784,493 I127F possibly damaging Het
Srcap A T 7: 127,538,750 T1091S probably benign Het
Syt14 A G 1: 192,930,695 I599T probably damaging Het
Themis2 A G 4: 132,785,980 Y312H probably benign Het
Tubgcp5 T G 7: 55,823,609 S812A probably benign Het
Ush2a A T 1: 188,850,040 I3767F probably damaging Het
Usp40 T A 1: 87,980,016 E626V probably damaging Het
Utrn T C 10: 12,690,876 R1181G probably benign Het
Vmn2r117 T A 17: 23,479,561 I13F probably damaging Het
Wdr34 C T 2: 30,031,751 A533T probably benign Het
Wdr48 G T 9: 119,924,709 V646F probably damaging Het
Wdr64 T C 1: 175,805,990 F936L possibly damaging Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0240:Tep1 UTSW 14 50863029 splice site probably benign
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0691:Tep1 UTSW 14 50866844 nonsense probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1686:Tep1 UTSW 14 50836788 missense probably benign 0.12
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 intron probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R4989:Tep1 UTSW 14 50839000 missense probably benign
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5386:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 intron probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
R7901:Tep1 UTSW 14 50826851 missense possibly damaging 0.88
R7984:Tep1 UTSW 14 50826851 missense possibly damaging 0.88
R8009:Tep1 UTSW 14 50824230 missense not run
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Z1177:Tep1 UTSW 14 50847765 missense not run
Predicted Primers PCR Primer
(F):5'- AATCGTCTCACCCCTGACCTAG -3'
(R):5'- GCACATAAGAAGTGGGGCTC -3'

Sequencing Primer
(F):5'- CTGTGGCCCTGCACCTG -3'
(R):5'- GGGGCTCAAATCTCAGGTTTC -3'
Posted On2017-06-26