Mutagenetix > Incidental Mutations

Incidental Mutation 'R6014:Tep1'

479935

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

044190-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6014 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50847000 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 907 (N907K)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444]

Predicted Effect

probably benign
Transcript: ENSMUST00000006444
AA Change: N907K

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: N907K

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000226430
AA Change: N182K

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226789

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	A	T	2: 35,354,869	M157K	probably benign	Het
A2ml1	C	T	6: 128,571,985	C278Y	probably damaging	Het
Abcc2	A	T	19: 43,826,735	Q1187L	probably benign	Het
Adcy9	A	T	16: 4,418,819	Y6N	probably damaging	Het
Adh1	T	C	3: 138,286,798	I225T	probably benign	Het
Akap11	A	T	14: 78,512,499	I816K	probably benign	Het
Ap1b1	T	A	11: 5,019,364	M240K	possibly damaging	Het
Apex1	A	T	14: 50,925,525	T17S	probably benign	Het
Arhgap21	C	T	2: 20,881,805	G26D	probably damaging	Het
Bahcc1	A	G	11: 120,289,789	Y2613C	probably benign	Het
Baz1b	C	T	5: 135,217,394	R566W	probably damaging	Het
Casp8ap2	A	T	4: 32,641,400	Y818F	probably damaging	Het
Col3a1	T	A	1: 45,321,579	C56*	probably null	Het
Coro2a	G	A	4: 46,542,261	P371S	probably damaging	Het
Cyp2a22	T	A	7: 26,939,180		probably null	Het
Dpysl3	T	A	18: 43,361,067	I183F	probably damaging	Het
Drc1	A	T	5: 30,345,649	N172I	probably damaging	Het
Dst	T	C	1: 34,264,834	Y1378H	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epb41l3	A	T	17: 69,283,960	T91S	probably damaging	Het
Exoc4	T	C	6: 33,475,997	V474A	probably benign	Het
Fam229b	G	A	10: 39,118,993	T56I	probably damaging	Het
Gfm2	A	G	13: 97,151,661		probably null	Het
Git2	C	T	5: 114,733,877	E152K	probably benign	Het
Golt1b	T	A	6: 142,396,217	I109N	probably damaging	Het
Grid2ip	T	A	5: 143,387,823	M783K	possibly damaging	Het
Inpp5a	A	G	7: 139,574,982	Y339C	probably damaging	Het
Isoc2a	T	C	7: 4,891,626	S103P	probably damaging	Het
Itih4	C	A	14: 30,892,629	Q483K	probably benign	Het
Kansl2	A	G	15: 98,520,316		probably null	Het
Kdm5d	G	A	Y: 921,528	A509T	probably benign	Het
Krt13	A	T	11: 100,117,611	D433E	unknown	Het
Lat2	C	T	5: 134,603,454	V142M	probably damaging	Het
Lemd1	A	C	1: 132,256,725	*102S	probably null	Het
Lrfn2	T	C	17: 49,069,906	L5P	possibly damaging	Het
Lrrc4c	T	G	2: 97,629,212		probably null	Het
Lypla1	T	A	1: 4,808,371		probably null	Het
Magi2	G	A	5: 20,611,093	G744R	probably damaging	Het
Myh14	T	A	7: 44,625,078	E948V	probably null	Het
Myo5a	C	A	9: 75,167,207	Y799*	probably null	Het
Nacc1	A	C	8: 84,675,071	M371R	possibly damaging	Het
Nlrp5	T	G	7: 23,409,947	M106R	probably benign	Het
Oas1h	C	T	5: 120,867,166	H226Y	possibly damaging	Het
Obscn	A	C	11: 59,038,864	I5175R	probably damaging	Het
Pcdh7	T	A	5: 57,721,155	I684N	probably damaging	Het
Pcdhb3	T	A	18: 37,302,653	N557K	probably damaging	Het
Pde3b	T	C	7: 114,416,440	L297S	probably damaging	Het
Pigv	G	T	4: 133,665,429	H143Q	probably benign	Het
Ptk2	T	G	15: 73,304,444	Y251S	possibly damaging	Het
Ralgds	A	G	2: 28,543,661	N219S	probably damaging	Het
Sardh	C	A	2: 27,197,528		probably null	Het
Serpina3b	A	T	12: 104,131,097	K212N	possibly damaging	Het
Sh3bp2	A	G	5: 34,559,627	N461D	probably benign	Het
Shisa2	A	T	14: 59,629,908	Q203L	probably damaging	Het
Shmt1	C	A	11: 60,797,557	G255V	probably damaging	Het
Socs1	T	A	16: 10,784,493	I127F	possibly damaging	Het
Srcap	A	T	7: 127,538,750	T1091S	probably benign	Het
Syt14	A	G	1: 192,930,695	I599T	probably damaging	Het
Themis2	A	G	4: 132,785,980	Y312H	probably benign	Het
Tubgcp5	T	G	7: 55,823,609	S812A	probably benign	Het
Ush2a	A	T	1: 188,850,040	I3767F	probably damaging	Het
Usp40	T	A	1: 87,980,016	E626V	probably damaging	Het
Utrn	T	C	10: 12,690,876	R1181G	probably benign	Het
Vmn2r117	T	A	17: 23,479,561	I13F	probably damaging	Het
Wdr34	C	T	2: 30,031,751	A533T	probably benign	Het
Wdr48	G	T	9: 119,924,709	V646F	probably damaging	Het
Wdr64	T	C	1: 175,805,990	F936L	possibly damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	intron	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4569:Tep1	UTSW	14	50824740	missense	probably benign	0.01
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	intron	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7984:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R8009:Tep1	UTSW	14	50824230	missense	not run
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	not run

Predicted Primers

PCR Primer
(F):5'- AATCGTCTCACCCCTGACCTAG -3'
(R):5'- GCACATAAGAAGTGGGGCTC -3'

Sequencing Primer
(F):5'- CTGTGGCCCTGCACCTG -3'
(R):5'- GGGGCTCAAATCTCAGGTTTC -3'

Posted On

2017-06-26