Incidental Mutation 'R6014:Ptk2'
ID479939
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene NamePTK2 protein tyrosine kinase 2
SynonymsFRNK, FAK, Fadk
MMRRC Submission 044190-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6014 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location73205102-73423280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 73304444 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 251 (Y251S)
Ref Sequence ENSEMBL: ENSMUSP00000154242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226791] [ENSMUST00000226988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110036
AA Change: Y251S

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: Y251S

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170939
AA Change: Y251S

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: Y251S

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 287 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226742
Predicted Effect probably benign
Transcript: ENSMUST00000226791
Predicted Effect possibly damaging
Transcript: ENSMUST00000226988
AA Change: Y251S

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228628
Meta Mutation Damage Score 0.1091 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik A T 2: 35,354,869 M157K probably benign Het
A2ml1 C T 6: 128,571,985 C278Y probably damaging Het
Abcc2 A T 19: 43,826,735 Q1187L probably benign Het
Adcy9 A T 16: 4,418,819 Y6N probably damaging Het
Adh1 T C 3: 138,286,798 I225T probably benign Het
Akap11 A T 14: 78,512,499 I816K probably benign Het
Ap1b1 T A 11: 5,019,364 M240K possibly damaging Het
Apex1 A T 14: 50,925,525 T17S probably benign Het
Arhgap21 C T 2: 20,881,805 G26D probably damaging Het
Bahcc1 A G 11: 120,289,789 Y2613C probably benign Het
Baz1b C T 5: 135,217,394 R566W probably damaging Het
Casp8ap2 A T 4: 32,641,400 Y818F probably damaging Het
Col3a1 T A 1: 45,321,579 C56* probably null Het
Coro2a G A 4: 46,542,261 P371S probably damaging Het
Cyp2a22 T A 7: 26,939,180 probably null Het
Dpysl3 T A 18: 43,361,067 I183F probably damaging Het
Drc1 A T 5: 30,345,649 N172I probably damaging Het
Dst T C 1: 34,264,834 Y1378H probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l3 A T 17: 69,283,960 T91S probably damaging Het
Exoc4 T C 6: 33,475,997 V474A probably benign Het
Fam229b G A 10: 39,118,993 T56I probably damaging Het
Gfm2 A G 13: 97,151,661 probably null Het
Git2 C T 5: 114,733,877 E152K probably benign Het
Golt1b T A 6: 142,396,217 I109N probably damaging Het
Grid2ip T A 5: 143,387,823 M783K possibly damaging Het
Inpp5a A G 7: 139,574,982 Y339C probably damaging Het
Isoc2a T C 7: 4,891,626 S103P probably damaging Het
Itih4 C A 14: 30,892,629 Q483K probably benign Het
Kansl2 A G 15: 98,520,316 probably null Het
Kdm5d G A Y: 921,528 A509T probably benign Het
Krt13 A T 11: 100,117,611 D433E unknown Het
Lat2 C T 5: 134,603,454 V142M probably damaging Het
Lemd1 A C 1: 132,256,725 *102S probably null Het
Lrfn2 T C 17: 49,069,906 L5P possibly damaging Het
Lrrc4c T G 2: 97,629,212 probably null Het
Lypla1 T A 1: 4,808,371 probably null Het
Magi2 G A 5: 20,611,093 G744R probably damaging Het
Myh14 T A 7: 44,625,078 E948V probably null Het
Myo5a C A 9: 75,167,207 Y799* probably null Het
Nacc1 A C 8: 84,675,071 M371R possibly damaging Het
Nlrp5 T G 7: 23,409,947 M106R probably benign Het
Oas1h C T 5: 120,867,166 H226Y possibly damaging Het
Obscn A C 11: 59,038,864 I5175R probably damaging Het
Pcdh7 T A 5: 57,721,155 I684N probably damaging Het
Pcdhb3 T A 18: 37,302,653 N557K probably damaging Het
Pde3b T C 7: 114,416,440 L297S probably damaging Het
Pigv G T 4: 133,665,429 H143Q probably benign Het
Ralgds A G 2: 28,543,661 N219S probably damaging Het
Sardh C A 2: 27,197,528 probably null Het
Serpina3b A T 12: 104,131,097 K212N possibly damaging Het
Sh3bp2 A G 5: 34,559,627 N461D probably benign Het
Shisa2 A T 14: 59,629,908 Q203L probably damaging Het
Shmt1 C A 11: 60,797,557 G255V probably damaging Het
Socs1 T A 16: 10,784,493 I127F possibly damaging Het
Srcap A T 7: 127,538,750 T1091S probably benign Het
Syt14 A G 1: 192,930,695 I599T probably damaging Het
Tep1 A T 14: 50,847,000 N907K probably benign Het
Themis2 A G 4: 132,785,980 Y312H probably benign Het
Tubgcp5 T G 7: 55,823,609 S812A probably benign Het
Ush2a A T 1: 188,850,040 I3767F probably damaging Het
Usp40 T A 1: 87,980,016 E626V probably damaging Het
Utrn T C 10: 12,690,876 R1181G probably benign Het
Vmn2r117 T A 17: 23,479,561 I13F probably damaging Het
Wdr34 C T 2: 30,031,751 A533T probably benign Het
Wdr48 G T 9: 119,924,709 V646F probably damaging Het
Wdr64 T C 1: 175,805,990 F936L possibly damaging Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R0239:Ptk2 UTSW 15 73343283 unclassified probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7079:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7090:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7091:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7798:Ptk2 UTSW 15 73295375 missense probably damaging 1.00
R8057:Ptk2 UTSW 15 73298199 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTTTCCCCTATAATTAAGTGTCAAGC -3'
(R):5'- CCTTTCAAACTGGTCTCAGGG -3'

Sequencing Primer
(F):5'- GTGTCAAGCAATATTTTTCTGTAAGG -3'
(R):5'- CAGCAAACATTCAGGCAG -3'
Posted On2017-06-26