Mutagenetix > Incidental Mutation

Incidental Mutation 'R6014:Vmn2r117'

479943

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

MMRRC Submission

044190-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R6014 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23479561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 13 (I13F)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000171996
AA Change: I13F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: I13F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (67/67)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	A	T	2: 35,354,869	M157K	probably benign	Het
A2ml1	C	T	6: 128,571,985	C278Y	probably damaging	Het
Abcc2	A	T	19: 43,826,735	Q1187L	probably benign	Het
Adcy9	A	T	16: 4,418,819	Y6N	probably damaging	Het
Adh1	T	C	3: 138,286,798	I225T	probably benign	Het
Akap11	A	T	14: 78,512,499	I816K	probably benign	Het
Ap1b1	T	A	11: 5,019,364	M240K	possibly damaging	Het
Apex1	A	T	14: 50,925,525	T17S	probably benign	Het
Arhgap21	C	T	2: 20,881,805	G26D	probably damaging	Het
Bahcc1	A	G	11: 120,289,789	Y2613C	probably benign	Het
Baz1b	C	T	5: 135,217,394	R566W	probably damaging	Het
Casp8ap2	A	T	4: 32,641,400	Y818F	probably damaging	Het
Col3a1	T	A	1: 45,321,579	C56*	probably null	Het
Coro2a	G	A	4: 46,542,261	P371S	probably damaging	Het
Cyp2a22	T	A	7: 26,939,180		probably null	Het
Dpysl3	T	A	18: 43,361,067	I183F	probably damaging	Het
Drc1	A	T	5: 30,345,649	N172I	probably damaging	Het
Dst	T	C	1: 34,264,834	Y1378H	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epb41l3	A	T	17: 69,283,960	T91S	probably damaging	Het
Exoc4	T	C	6: 33,475,997	V474A	probably benign	Het
Fam229b	G	A	10: 39,118,993	T56I	probably damaging	Het
Gfm2	A	G	13: 97,151,661		probably null	Het
Git2	C	T	5: 114,733,877	E152K	probably benign	Het
Golt1b	T	A	6: 142,396,217	I109N	probably damaging	Het
Grid2ip	T	A	5: 143,387,823	M783K	possibly damaging	Het
Inpp5a	A	G	7: 139,574,982	Y339C	probably damaging	Het
Isoc2a	T	C	7: 4,891,626	S103P	probably damaging	Het
Itih4	C	A	14: 30,892,629	Q483K	probably benign	Het
Kansl2	A	G	15: 98,520,316		probably null	Het
Kdm5d	G	A	Y: 921,528	A509T	probably benign	Het
Krt13	A	T	11: 100,117,611	D433E	unknown	Het
Lat2	C	T	5: 134,603,454	V142M	probably damaging	Het
Lemd1	A	C	1: 132,256,725	*102S	probably null	Het
Lrfn2	T	C	17: 49,069,906	L5P	possibly damaging	Het
Lrrc4c	T	G	2: 97,629,212		probably null	Het
Lypla1	T	A	1: 4,808,371		probably null	Het
Magi2	G	A	5: 20,611,093	G744R	probably damaging	Het
Myh14	T	A	7: 44,625,078	E948V	probably null	Het
Myo5a	C	A	9: 75,167,207	Y799*	probably null	Het
Nacc1	A	C	8: 84,675,071	M371R	possibly damaging	Het
Nlrp5	T	G	7: 23,409,947	M106R	probably benign	Het
Oas1h	C	T	5: 120,867,166	H226Y	possibly damaging	Het
Obscn	A	C	11: 59,038,864	I5175R	probably damaging	Het
Pcdh7	T	A	5: 57,721,155	I684N	probably damaging	Het
Pcdhb3	T	A	18: 37,302,653	N557K	probably damaging	Het
Pde3b	T	C	7: 114,416,440	L297S	probably damaging	Het
Pigv	G	T	4: 133,665,429	H143Q	probably benign	Het
Ptk2	T	G	15: 73,304,444	Y251S	possibly damaging	Het
Ralgds	A	G	2: 28,543,661	N219S	probably damaging	Het
Sardh	C	A	2: 27,197,528		probably null	Het
Serpina3b	A	T	12: 104,131,097	K212N	possibly damaging	Het
Sh3bp2	A	G	5: 34,559,627	N461D	probably benign	Het
Shisa2	A	T	14: 59,629,908	Q203L	probably damaging	Het
Shmt1	C	A	11: 60,797,557	G255V	probably damaging	Het
Socs1	T	A	16: 10,784,493	I127F	possibly damaging	Het
Srcap	A	T	7: 127,538,750	T1091S	probably benign	Het
Syt14	A	G	1: 192,930,695	I599T	probably damaging	Het
Tep1	A	T	14: 50,847,000	N907K	probably benign	Het
Themis2	A	G	4: 132,785,980	Y312H	probably benign	Het
Tubgcp5	T	G	7: 55,823,609	S812A	probably benign	Het
Ush2a	A	T	1: 188,850,040	I3767F	probably damaging	Het
Usp40	T	A	1: 87,980,016	E626V	probably damaging	Het
Utrn	T	C	10: 12,690,876	R1181G	probably benign	Het
Wdr34	C	T	2: 30,031,751	A533T	probably benign	Het
Wdr48	G	T	9: 119,924,709	V646F	probably damaging	Het
Wdr64	T	C	1: 175,805,990	F936L	possibly damaging	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTTGGGAAACATTCATGATGACTG -3'
(R):5'- TCAATGATTCCTCCAGGGGTG -3'

Sequencing Primer
(F):5'- CATGATGACTGTACATGGAAAACAC -3'
(R):5'- TTCCTCCAGGGGTGAGGAAAC -3'

Posted On

2017-06-26