Incidental Mutation 'R6025:Chd6'
ID 479957
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 5430439G14Rik, 6330406J24Rik
MMRRC Submission 044197-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.745) question?
Stock # R6025 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160788898-160950995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160807502 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1904 (N1904S)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039782
AA Change: N1904S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: N1904S

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,101,139 (GRCm39) probably null Het
Acvr1b C A 15: 101,092,856 (GRCm39) D166E probably benign Het
Adgra2 T C 8: 27,604,491 (GRCm39) I522T probably damaging Het
Adgre4 C T 17: 56,099,013 (GRCm39) S173L probably benign Het
Akap9 A T 5: 4,082,801 (GRCm39) Q1975L probably damaging Het
Ap3d1 T A 10: 80,546,298 (GRCm39) M965L probably benign Het
Brca2 CATA CA 5: 150,465,040 (GRCm39) probably null Het
Clstn3 A T 6: 124,408,623 (GRCm39) S896R possibly damaging Het
Col6a3 T A 1: 90,755,824 (GRCm39) D155V probably damaging Het
Dct T C 14: 118,273,876 (GRCm39) T344A possibly damaging Het
Dctn1 T A 6: 83,170,673 (GRCm39) probably null Het
Dgkz T C 2: 91,776,255 (GRCm39) T3A possibly damaging Het
Duoxa2 T C 2: 122,132,332 (GRCm39) S249P possibly damaging Het
Ehbp1 A T 11: 22,189,156 (GRCm39) V82E probably damaging Het
Fcho1 A T 8: 72,165,217 (GRCm39) probably null Het
Garin5b T A 7: 4,761,143 (GRCm39) D523V probably benign Het
Ifi213 T A 1: 173,422,800 (GRCm39) N22Y probably damaging Het
Kcnq1 T A 7: 142,660,170 (GRCm39) probably benign Het
Kif7 T A 7: 79,354,388 (GRCm39) Q799L probably benign Het
Lmnb1 T A 18: 56,862,456 (GRCm39) L206* probably null Het
Lonp2 G T 8: 87,440,001 (GRCm39) G247V probably damaging Het
Ly75 T C 2: 60,206,306 (GRCm39) Y121C probably damaging Het
Mboat1 C A 13: 30,408,509 (GRCm39) T224K probably benign Het
Mcm9 T C 10: 53,492,073 (GRCm39) E416G possibly damaging Het
Mtnr1b A T 9: 15,774,093 (GRCm39) I322N probably damaging Het
Nanog G A 6: 122,690,350 (GRCm39) G227R possibly damaging Het
Nbn T C 4: 15,981,347 (GRCm39) S480P probably damaging Het
Nek10 C A 14: 14,865,633 (GRCm38) L638M probably benign Het
Nelfcd T C 2: 174,268,611 (GRCm39) V538A probably damaging Het
Or1e33 A T 11: 73,738,745 (GRCm39) S69T probably benign Het
Or2b4 T G 17: 38,116,312 (GRCm39) I92S probably damaging Het
Or52a5b T C 7: 103,417,416 (GRCm39) I63V probably benign Het
Or5b97 T A 19: 12,879,034 (GRCm39) T37S probably benign Het
Phf24 G A 4: 42,938,780 (GRCm39) probably null Het
Pigz T C 16: 31,764,528 (GRCm39) S529P probably damaging Het
Pik3r5 A G 11: 68,383,144 (GRCm39) E321G probably damaging Het
Plcb3 G A 19: 6,933,547 (GRCm39) T926I probably benign Het
Pm20d2 G A 4: 33,181,833 (GRCm39) P257S probably damaging Het
Pon2 A G 6: 5,289,057 (GRCm39) V34A probably benign Het
Prkar2b A G 12: 32,110,855 (GRCm39) F76S possibly damaging Het
Prpf31 G A 7: 3,642,668 (GRCm39) E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Setbp1 A T 18: 78,902,455 (GRCm39) L404Q probably damaging Het
Slc26a11 C T 11: 119,265,654 (GRCm39) A389V probably damaging Het
Slc2a1 A T 4: 118,993,539 (GRCm39) T459S possibly damaging Het
Spi1 T C 2: 90,944,685 (GRCm39) L135P probably benign Het
Sspo T C 6: 48,463,720 (GRCm39) L3844P possibly damaging Het
Stxbp5 T A 10: 9,675,772 (GRCm39) T616S probably benign Het
Syde2 A G 3: 145,712,896 (GRCm39) probably null Het
Synm G T 7: 67,384,686 (GRCm39) A550D possibly damaging Het
Tanc2 T C 11: 105,787,373 (GRCm39) V891A possibly damaging Het
Tanc2 G A 11: 105,758,543 (GRCm39) R768Q probably damaging Het
Tlx1 A T 19: 45,144,413 (GRCm39) Q45L probably damaging Het
Tmem104 C A 11: 115,096,349 (GRCm39) Y191* probably null Het
Tmem17 A C 11: 22,468,659 (GRCm39) *199C probably null Het
Tns3 A T 11: 8,442,578 (GRCm39) M595K possibly damaging Het
Tyk2 A G 9: 21,027,256 (GRCm39) V538A probably benign Het
Unc80 A G 1: 66,734,727 (GRCm39) D3250G possibly damaging Het
Usp4 A G 9: 108,237,322 (GRCm39) H130R possibly damaging Het
Zfhx2 T C 14: 55,302,665 (GRCm39) Q1773R probably benign Het
Zfp790 A G 7: 29,528,970 (GRCm39) K552E possibly damaging Het
Zswim5 G A 4: 116,808,106 (GRCm39) R230Q probably damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 160,883,999 (GRCm39) missense probably benign 0.01
IGL00899:Chd6 APN 2 160,871,218 (GRCm39) splice site probably benign
IGL01104:Chd6 APN 2 160,803,847 (GRCm39) missense probably damaging 1.00
IGL01295:Chd6 APN 2 160,830,290 (GRCm39) splice site probably benign
IGL01717:Chd6 APN 2 160,807,179 (GRCm39) missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160,803,294 (GRCm39) missense probably benign 0.00
IGL01814:Chd6 APN 2 160,901,849 (GRCm39) missense probably benign 0.25
IGL02016:Chd6 APN 2 160,825,598 (GRCm39) missense probably damaging 1.00
IGL02104:Chd6 APN 2 160,819,432 (GRCm39) missense probably benign
IGL02158:Chd6 APN 2 160,868,212 (GRCm39) missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160,807,595 (GRCm39) missense probably damaging 1.00
IGL02472:Chd6 APN 2 160,826,372 (GRCm39) splice site probably benign
IGL02522:Chd6 APN 2 160,807,716 (GRCm39) missense probably benign 0.30
IGL02626:Chd6 APN 2 160,881,270 (GRCm39) splice site probably benign
IGL02727:Chd6 APN 2 160,811,383 (GRCm39) missense probably damaging 0.96
IGL02738:Chd6 APN 2 160,807,618 (GRCm39) missense probably benign 0.45
IGL02743:Chd6 APN 2 160,802,183 (GRCm39) missense probably damaging 1.00
IGL02800:Chd6 APN 2 160,826,552 (GRCm39) missense probably damaging 1.00
IGL02811:Chd6 APN 2 160,832,221 (GRCm39) missense probably damaging 1.00
IGL02850:Chd6 APN 2 160,861,536 (GRCm39) nonsense probably null
IGL02979:Chd6 APN 2 160,808,090 (GRCm39) missense possibly damaging 0.48
IGL02993:Chd6 APN 2 160,894,304 (GRCm39) splice site probably benign
IGL03277:Chd6 APN 2 160,824,981 (GRCm39) missense probably null 1.00
IGL03346:Chd6 APN 2 160,802,282 (GRCm39) missense probably benign 0.00
IGL03357:Chd6 APN 2 160,859,936 (GRCm39) splice site probably benign
IGL03134:Chd6 UTSW 2 160,807,403 (GRCm39) missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0212:Chd6 UTSW 2 160,894,767 (GRCm39) missense probably damaging 0.99
R0363:Chd6 UTSW 2 160,856,244 (GRCm39) missense probably damaging 1.00
R0399:Chd6 UTSW 2 160,894,608 (GRCm39) missense probably damaging 1.00
R0511:Chd6 UTSW 2 160,834,111 (GRCm39) missense probably damaging 0.99
R0771:Chd6 UTSW 2 160,861,500 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1184:Chd6 UTSW 2 160,872,722 (GRCm39) missense probably damaging 1.00
R1277:Chd6 UTSW 2 160,809,735 (GRCm39) missense probably damaging 1.00
R1396:Chd6 UTSW 2 160,825,023 (GRCm39) missense probably damaging 1.00
R1647:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1648:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1745:Chd6 UTSW 2 160,823,587 (GRCm39) missense probably damaging 0.96
R1766:Chd6 UTSW 2 160,808,559 (GRCm39) missense probably damaging 1.00
R1871:Chd6 UTSW 2 160,832,176 (GRCm39) missense probably damaging 1.00
R1928:Chd6 UTSW 2 160,809,920 (GRCm39) splice site probably benign
R1973:Chd6 UTSW 2 160,808,307 (GRCm39) missense probably damaging 0.99
R2200:Chd6 UTSW 2 160,825,673 (GRCm39) missense probably damaging 1.00
R2340:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2341:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2519:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160,809,800 (GRCm39) missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160,808,472 (GRCm39) small deletion probably benign
R3426:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R3427:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R4042:Chd6 UTSW 2 160,830,253 (GRCm39) missense probably damaging 1.00
R4273:Chd6 UTSW 2 160,803,211 (GRCm39) missense probably benign 0.04
R4360:Chd6 UTSW 2 160,791,776 (GRCm39) missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160,807,238 (GRCm39) missense probably benign
R4458:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R4583:Chd6 UTSW 2 160,856,114 (GRCm39) missense probably damaging 1.00
R4625:Chd6 UTSW 2 160,811,412 (GRCm39) missense probably damaging 1.00
R4740:Chd6 UTSW 2 160,812,103 (GRCm39) missense probably benign
R4765:Chd6 UTSW 2 160,808,164 (GRCm39) nonsense probably null
R4779:Chd6 UTSW 2 160,791,477 (GRCm39) missense probably damaging 1.00
R4877:Chd6 UTSW 2 160,871,219 (GRCm39) splice site probably benign
R5068:Chd6 UTSW 2 160,808,289 (GRCm39) missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160,791,873 (GRCm39) missense probably damaging 1.00
R5275:Chd6 UTSW 2 160,811,283 (GRCm39) missense probably benign
R5405:Chd6 UTSW 2 160,807,310 (GRCm39) missense probably benign
R5598:Chd6 UTSW 2 160,856,032 (GRCm39) missense probably damaging 1.00
R5693:Chd6 UTSW 2 160,807,185 (GRCm39) missense probably benign
R5697:Chd6 UTSW 2 160,859,971 (GRCm39) missense probably damaging 1.00
R5715:Chd6 UTSW 2 160,791,798 (GRCm39) missense probably benign 0.00
R5759:Chd6 UTSW 2 160,825,682 (GRCm39) missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160,798,999 (GRCm39) missense probably damaging 1.00
R5761:Chd6 UTSW 2 160,798,998 (GRCm39) missense probably damaging 1.00
R5954:Chd6 UTSW 2 160,807,747 (GRCm39) missense probably benign 0.00
R6104:Chd6 UTSW 2 160,856,052 (GRCm39) missense probably damaging 1.00
R6247:Chd6 UTSW 2 160,791,968 (GRCm39) missense probably damaging 1.00
R6393:Chd6 UTSW 2 160,821,407 (GRCm39) missense probably damaging 1.00
R6452:Chd6 UTSW 2 160,807,418 (GRCm39) missense possibly damaging 0.76
R6468:Chd6 UTSW 2 160,854,987 (GRCm39) missense probably damaging 1.00
R6784:Chd6 UTSW 2 160,808,174 (GRCm39) missense probably damaging 1.00
R6803:Chd6 UTSW 2 160,802,279 (GRCm39) missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160,807,650 (GRCm39) missense probably benign
R6895:Chd6 UTSW 2 160,830,260 (GRCm39) missense probably damaging 1.00
R6925:Chd6 UTSW 2 160,855,047 (GRCm39) missense probably damaging 0.98
R7061:Chd6 UTSW 2 160,867,885 (GRCm39) nonsense probably null
R7064:Chd6 UTSW 2 160,791,983 (GRCm39) missense probably damaging 1.00
R7248:Chd6 UTSW 2 160,803,199 (GRCm39) nonsense probably null
R7287:Chd6 UTSW 2 160,850,312 (GRCm39) missense probably benign 0.07
R7431:Chd6 UTSW 2 160,868,248 (GRCm39) missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160,791,923 (GRCm39) missense probably damaging 1.00
R7509:Chd6 UTSW 2 160,855,074 (GRCm39) missense probably damaging 1.00
R7699:Chd6 UTSW 2 160,867,863 (GRCm39) missense probably benign 0.13
R7748:Chd6 UTSW 2 160,808,539 (GRCm39) missense probably benign 0.37
R7785:Chd6 UTSW 2 160,812,095 (GRCm39) missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8261:Chd6 UTSW 2 160,799,002 (GRCm39) missense probably damaging 1.00
R8317:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8388:Chd6 UTSW 2 160,861,571 (GRCm39) missense probably damaging 1.00
R8865:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8867:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8996:Chd6 UTSW 2 160,823,543 (GRCm39) missense probably damaging 1.00
R9091:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9270:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9310:Chd6 UTSW 2 160,881,181 (GRCm39) missense probably damaging 1.00
R9367:Chd6 UTSW 2 160,871,784 (GRCm39) missense possibly damaging 0.83
R9438:Chd6 UTSW 2 160,799,078 (GRCm39) missense probably benign 0.01
R9756:Chd6 UTSW 2 160,802,259 (GRCm39) missense probably benign
Z1088:Chd6 UTSW 2 160,808,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCTGTACAGGTCTGGC -3'
(R):5'- GTAGTCTTAGTGTCTATGACCCC -3'

Sequencing Primer
(F):5'- CTGTACAGGTCTGGCTGATAAGC -3'
(R):5'- GTCTTAGTGTCTATGACCCCAAAAG -3'
Posted On 2017-06-26