Mutagenetix > Incidental Mutations

Incidental Mutation 'R6025:Brca2'

479964

Institutional Source

Beutler Lab

Gene Symbol

Brca2

Ensembl Gene

ENSMUSG00000041147

Gene Name

breast cancer 2, early onset

Synonyms

Fancd1, RAB163

MMRRC Submission

044197-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6025 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

150522630-150570329 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CATA to CA at 150541575 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]

Predicted Effect

probably null
Transcript: ENSMUST00000044620

SMART Domains

Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202003

SMART Domains

Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202313

SMART Domains

Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202975

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	GC	G	11: 59,210,313		probably null	Het
Acvr1b	C	A	15: 101,194,975	D166E	probably benign	Het
Adgra2	T	C	8: 27,114,463	I522T	probably damaging	Het
Adgre4	C	T	17: 55,792,013	S173L	probably benign	Het
Akap9	A	T	5: 4,032,801	Q1975L	probably damaging	Het
Ap3d1	T	A	10: 80,710,464	M965L	probably benign	Het
Chd6	T	C	2: 160,965,582	N1904S	probably benign	Het
Clstn3	A	T	6: 124,431,664	S896R	possibly damaging	Het
Col6a3	T	A	1: 90,828,102	D155V	probably damaging	Het
Dct	T	C	14: 118,036,464	T344A	possibly damaging	Het
Dctn1	T	A	6: 83,193,691		probably null	Het
Dgkz	T	C	2: 91,945,910	T3A	possibly damaging	Het
Duoxa2	T	C	2: 122,301,851	S249P	possibly damaging	Het
Ehbp1	A	T	11: 22,239,156	V82E	probably damaging	Het
Fam71e2	T	A	7: 4,758,144	D523V	probably benign	Het
Fcho1	A	T	8: 71,712,573		probably null	Het
Ifi213	T	A	1: 173,595,234	N22Y	probably damaging	Het
Kcnq1	T	A	7: 143,106,433		probably benign	Het
Kif7	T	A	7: 79,704,640	Q799L	probably benign	Het
Lmnb1	T	A	18: 56,729,384	L206*	probably null	Het
Lonp2	G	T	8: 86,713,373	G247V	probably damaging	Het
Ly75	T	C	2: 60,375,962	Y121C	probably damaging	Het
Mboat1	C	A	13: 30,224,526	T224K	probably benign	Het
Mcm9	T	C	10: 53,615,977	E416G	possibly damaging	Het
Mtnr1b	A	T	9: 15,862,797	I322N	probably damaging	Het
Nanog	G	A	6: 122,713,391	G227R	possibly damaging	Het
Nbn	T	C	4: 15,981,347	S480P	probably damaging	Het
Nek10	C	A	14: 14,865,633	L638M	probably benign	Het
Nelfcd	T	C	2: 174,426,818	V538A	probably damaging	Het
Olfr124	T	G	17: 37,805,421	I92S	probably damaging	Het
Olfr1447	T	A	19: 12,901,670	T37S	probably benign	Het
Olfr393	A	T	11: 73,847,919	S69T	probably benign	Het
Olfr69	T	C	7: 103,768,209	I63V	probably benign	Het
Phf24	G	A	4: 42,938,780		probably null	Het
Pigz	T	C	16: 31,945,710	S529P	probably damaging	Het
Pik3r5	A	G	11: 68,492,318	E321G	probably damaging	Het
Plcb3	G	A	19: 6,956,179	T926I	probably benign	Het
Pm20d2	G	A	4: 33,181,833	P257S	probably damaging	Het
Pon2	A	G	6: 5,289,057	V34A	probably benign	Het
Prkar2b	A	G	12: 32,060,856	F76S	possibly damaging	Het
Prpf31	G	A	7: 3,639,669	E414K	probably benign	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Setbp1	A	T	18: 78,859,240	L404Q	probably damaging	Het
Slc26a11	C	T	11: 119,374,828	A389V	probably damaging	Het
Slc2a1	A	T	4: 119,136,342	T459S	possibly damaging	Het
Spi1	T	C	2: 91,114,340	L135P	probably benign	Het
Sspo	T	C	6: 48,486,786	L3844P	possibly damaging	Het
Stxbp5	T	A	10: 9,800,028	T616S	probably benign	Het
Syde2	A	G	3: 146,007,141		probably null	Het
Synm	G	T	7: 67,734,938	A550D	possibly damaging	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tanc2	T	C	11: 105,896,547	V891A	possibly damaging	Het
Tlx1	A	T	19: 45,155,974	Q45L	probably damaging	Het
Tmem104	C	A	11: 115,205,523	Y191*	probably null	Het
Tmem17	A	C	11: 22,518,659	*199C	probably null	Het
Tns3	A	T	11: 8,492,578	M595K	possibly damaging	Het
Tyk2	A	G	9: 21,115,960	V538A	probably benign	Het
Unc80	A	G	1: 66,695,568	D3250G	possibly damaging	Het
Usp4	A	G	9: 108,360,123	H130R	possibly damaging	Het
Zfhx2	T	C	14: 55,065,208	Q1773R	probably benign	Het
Zfp790	A	G	7: 29,829,545	K552E	possibly damaging	Het
Zswim5	G	A	4: 116,950,909	R230Q	probably damaging	Het

Other mutations in Brca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Brca2	APN	5	150539898	missense	probably benign	0.18
IGL00392:Brca2	APN	5	150541240	missense	probably benign	0.02
IGL00557:Brca2	APN	5	150560538	missense	probably benign
IGL00798:Brca2	APN	5	150539463	missense	probably benign	0.30
IGL00933:Brca2	APN	5	150542404	missense	probably benign	0.04
IGL00964:Brca2	APN	5	150532310	missense	probably damaging	1.00
IGL01152:Brca2	APN	5	150542390	missense	probably damaging	0.99
IGL01577:Brca2	APN	5	150541620	nonsense	probably null
IGL01585:Brca2	APN	5	150539516	missense	possibly damaging	0.76
IGL01732:Brca2	APN	5	150542387	missense	probably benign	0.13
IGL01809:Brca2	APN	5	150531061	splice site	probably null
IGL01911:Brca2	APN	5	150567613	missense	probably damaging	0.96
IGL02113:Brca2	APN	5	150540979	missense	possibly damaging	0.95
IGL02313:Brca2	APN	5	150538661	missense	probably damaging	1.00
IGL02342:Brca2	APN	5	150542824	missense	possibly damaging	0.94
IGL02508:Brca2	APN	5	150543308	missense	possibly damaging	0.85
IGL02532:Brca2	APN	5	150550862	missense	probably damaging	1.00
IGL02646:Brca2	APN	5	150560790	missense	possibly damaging	0.89
IGL02738:Brca2	APN	5	150567035	missense	probably damaging	1.00
IGL02833:Brca2	APN	5	150541790	missense	possibly damaging	0.83
IGL02871:Brca2	APN	5	150542552	missense	probably benign	0.13
IGL02995:Brca2	APN	5	150529488	missense	probably damaging	1.00
IGL03105:Brca2	APN	5	150560485	missense	probably benign	0.02
R0219:Brca2	UTSW	5	150523175	splice site	probably benign
R0416:Brca2	UTSW	5	150569392	missense	possibly damaging	0.93
R0441:Brca2	UTSW	5	150541857	missense	probably damaging	0.96
R0548:Brca2	UTSW	5	150544935	missense	probably damaging	0.96
R0745:Brca2	UTSW	5	150544882	splice site	probably benign
R0799:Brca2	UTSW	5	150560193	missense	probably damaging	0.99
R1165:Brca2	UTSW	5	150542747	missense	probably damaging	0.98
R1247:Brca2	UTSW	5	150541274	missense	probably damaging	1.00
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1444:Brca2	UTSW	5	150542450	missense	probably benign
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1584:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1599:Brca2	UTSW	5	150548713	nonsense	probably null
R1600:Brca2	UTSW	5	150560830	splice site	probably benign
R1822:Brca2	UTSW	5	150540198	missense	probably benign	0.06
R1824:Brca2	UTSW	5	150536922	missense	possibly damaging	0.94
R2037:Brca2	UTSW	5	150540669	missense	probably benign
R2131:Brca2	UTSW	5	150557129	missense	probably damaging	1.00
R2203:Brca2	UTSW	5	150539502	missense	possibly damaging	0.58
R2208:Brca2	UTSW	5	150532344	missense	probably damaging	0.96
R2293:Brca2	UTSW	5	150560534	missense	possibly damaging	0.86
R2517:Brca2	UTSW	5	150539672	missense	probably benign	0.04
R2566:Brca2	UTSW	5	150541762	missense	probably benign	0.03
R3422:Brca2	UTSW	5	150543121	missense	possibly damaging	0.91
R3917:Brca2	UTSW	5	150540827	missense	probably damaging	0.96
R3946:Brca2	UTSW	5	150536704	missense	probably damaging	0.96
R4176:Brca2	UTSW	5	150539633	nonsense	probably null
R4255:Brca2	UTSW	5	150541169	missense	possibly damaging	0.92
R4450:Brca2	UTSW	5	150536053	missense	probably damaging	0.96
R4603:Brca2	UTSW	5	150536165	missense	possibly damaging	0.86
R4681:Brca2	UTSW	5	150552398	splice site	probably null
R4755:Brca2	UTSW	5	150559987	intron	probably null
R4762:Brca2	UTSW	5	150531116	missense	probably benign	0.00
R4824:Brca2	UTSW	5	150539735	missense	probably damaging	1.00
R4887:Brca2	UTSW	5	150556937	missense	probably damaging	1.00
R5020:Brca2	UTSW	5	150560436	missense	probably damaging	1.00
R5159:Brca2	UTSW	5	150542108	missense	possibly damaging	0.93
R5216:Brca2	UTSW	5	150542980	missense	probably damaging	0.99
R5269:Brca2	UTSW	5	150539223	missense	possibly damaging	0.75
R5274:Brca2	UTSW	5	150539689	missense	probably benign	0.00
R5589:Brca2	UTSW	5	150557132	missense	possibly damaging	0.67
R5619:Brca2	UTSW	5	150557114	missense	probably damaging	0.96
R5641:Brca2	UTSW	5	150556899	missense	probably damaging	1.00
R5686:Brca2	UTSW	5	150540904	missense	probably benign	0.00
R5730:Brca2	UTSW	5	150569005	missense	possibly damaging	0.85
R5763:Brca2	UTSW	5	150548006	missense	possibly damaging	0.85
R5877:Brca2	UTSW	5	150543221	missense	possibly damaging	0.53
R5893:Brca2	UTSW	5	150569138	missense	probably benign	0.02
R5900:Brca2	UTSW	5	150541132	missense	probably benign	0.01
R5926:Brca2	UTSW	5	150534622	missense	probably benign	0.07
R5966:Brca2	UTSW	5	150543251	missense	probably damaging	0.99
R6062:Brca2	UTSW	5	150556889	missense	probably damaging	0.96
R6141:Brca2	UTSW	5	150540637	missense	possibly damaging	0.91
R6244:Brca2	UTSW	5	150566978	missense	probably benign	0.08
R6508:Brca2	UTSW	5	150536593	missense	possibly damaging	0.91
R6519:Brca2	UTSW	5	150540979	missense	probably damaging	0.99
R6611:Brca2	UTSW	5	150536193	missense	probably damaging	0.99
R6698:Brca2	UTSW	5	150532394	missense	probably damaging	1.00
R6856:Brca2	UTSW	5	150540208	missense	possibly damaging	0.68
R6912:Brca2	UTSW	5	150541742	missense	probably damaging	0.99
R7002:Brca2	UTSW	5	150539918	missense	probably benign
R7025:Brca2	UTSW	5	150540478	missense	probably benign	0.39
R7151:Brca2	UTSW	5	150541436	missense	probably benign	0.12
R7202:Brca2	UTSW	5	150532354	missense	probably benign	0.03
R7365:Brca2	UTSW	5	150532337	missense	probably damaging	0.99
R7510:Brca2	UTSW	5	150536691	missense	possibly damaging	0.85
R7612:Brca2	UTSW	5	150540611	missense	probably benign	0.03
R7682:Brca2	UTSW	5	150543153	missense	probably benign
R7890:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R7973:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R8054:Brca2	UTSW	5	150536504	missense	probably benign	0.02
R8056:Brca2	UTSW	5	150569306	missense	possibly damaging	0.85
Z1088:Brca2	UTSW	5	150542763	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGGATCAAAACCCCTGAAGG -3'
(R):5'- TGCAAAATCTTCTGTGTGTTCC -3'

Sequencing Primer
(F):5'- CCCCTGAAGGACAGTAAAAA -3'
(R):5'- GCAAAATCTTCTGTGTGTTCCTTTAC -3'

Posted On

2017-06-26