Incidental Mutation 'R6025:Fam71e2'
ID479970
Institutional Source Beutler Lab
Gene Symbol Fam71e2
Ensembl Gene ENSMUSG00000092518
Gene Namefamily with sequence similarity 71, member E2
Synonyms
MMRRC Submission 044197-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6025 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4753226-4771302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4758144 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 523 (D523V)
Ref Sequence ENSEMBL: ENSMUSP00000133885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163574] [ENSMUST00000174409]
Predicted Effect probably benign
Transcript: ENSMUST00000163574
SMART Domains Protein: ENSMUSP00000137684
Gene: ENSMUSG00000092518

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174409
AA Change: D523V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000133885
Gene: ENSMUSG00000092518
AA Change: D523V

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:DUF3699 93 168 5.8e-24 PFAM
low complexity region 277 291 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dctn1 T A 6: 83,193,691 probably null Het
Dgkz T C 2: 91,945,910 T3A possibly damaging Het
Duoxa2 T C 2: 122,301,851 S249P possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kcnq1 T A 7: 143,106,433 probably benign Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Lonp2 G T 8: 86,713,373 G247V probably damaging Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Stxbp5 T A 10: 9,800,028 T616S probably benign Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tns3 A T 11: 8,492,578 M595K possibly damaging Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Fam71e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Fam71e2 APN 7 4757527 missense probably damaging 0.99
IGL01622:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01623:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01944:Fam71e2 APN 7 4770695 missense possibly damaging 0.94
IGL03013:Fam71e2 APN 7 4758633 missense probably benign 0.14
IGL03029:Fam71e2 APN 7 4757840 missense possibly damaging 0.78
R0153:Fam71e2 UTSW 7 4770287 missense probably damaging 0.99
R0523:Fam71e2 UTSW 7 4759393 missense possibly damaging 0.74
R0981:Fam71e2 UTSW 7 4757589 splice site probably null
R1428:Fam71e2 UTSW 7 4757688 missense possibly damaging 0.68
R1736:Fam71e2 UTSW 7 4758154 missense probably damaging 1.00
R1929:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R1993:Fam71e2 UTSW 7 4758018 missense probably damaging 1.00
R2016:Fam71e2 UTSW 7 4759398 missense probably damaging 1.00
R2256:Fam71e2 UTSW 7 4771021 missense probably benign 0.01
R2270:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2271:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2272:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R4288:Fam71e2 UTSW 7 4770723 missense possibly damaging 0.91
R4653:Fam71e2 UTSW 7 4758055 missense possibly damaging 0.95
R4812:Fam71e2 UTSW 7 4759072 missense probably damaging 1.00
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R5037:Fam71e2 UTSW 7 4758576 missense possibly damaging 0.64
R5044:Fam71e2 UTSW 7 4758661 missense probably benign 0.00
R5491:Fam71e2 UTSW 7 4757926 missense probably benign 0.05
R5559:Fam71e2 UTSW 7 4758450 missense probably damaging 1.00
R5919:Fam71e2 UTSW 7 4770386 missense possibly damaging 0.92
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6164:Fam71e2 UTSW 7 4770678 missense probably damaging 0.99
R6371:Fam71e2 UTSW 7 4759359 missense probably benign 0.06
R6470:Fam71e2 UTSW 7 4757851 missense probably benign 0.16
R6546:Fam71e2 UTSW 7 4758465 missense probably benign 0.06
R6603:Fam71e2 UTSW 7 4758432 missense possibly damaging 0.95
R7037:Fam71e2 UTSW 7 4758585 utr 3 prime probably benign
R7381:Fam71e2 UTSW 7 4757682 missense
Z1177:Fam71e2 UTSW 7 4757728 missense
Predicted Primers PCR Primer
(F):5'- TCTTGGTAGTGGCAAAGGGC -3'
(R):5'- TGCACTTGGCCATTTCTTTAAG -3'

Sequencing Primer
(F):5'- TGGCAAAGGGCAGATGC -3'
(R):5'- GGCCATTTCTTTAAGTCTCAGC -3'
Posted On2017-06-26