Mutagenetix > Incidental Mutations

Incidental Mutation 'R6025:Ap3d1'

479984

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

044197-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R6025 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80710464 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 965 (M965L)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218610]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: M965L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: M965L

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

unknown
Transcript: ENSMUST00000218610
AA Change: M36L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219816

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	GC	G	11: 59,210,313		probably null	Het
Acvr1b	C	A	15: 101,194,975	D166E	probably benign	Het
Adgra2	T	C	8: 27,114,463	I522T	probably damaging	Het
Adgre4	C	T	17: 55,792,013	S173L	probably benign	Het
Akap9	A	T	5: 4,032,801	Q1975L	probably damaging	Het
Brca2	CATA	CA	5: 150,541,575		probably null	Het
Chd6	T	C	2: 160,965,582	N1904S	probably benign	Het
Clstn3	A	T	6: 124,431,664	S896R	possibly damaging	Het
Col6a3	T	A	1: 90,828,102	D155V	probably damaging	Het
Dct	T	C	14: 118,036,464	T344A	possibly damaging	Het
Dctn1	T	A	6: 83,193,691		probably null	Het
Dgkz	T	C	2: 91,945,910	T3A	possibly damaging	Het
Duoxa2	T	C	2: 122,301,851	S249P	possibly damaging	Het
Ehbp1	A	T	11: 22,239,156	V82E	probably damaging	Het
Fam71e2	T	A	7: 4,758,144	D523V	probably benign	Het
Fcho1	A	T	8: 71,712,573		probably null	Het
Ifi213	T	A	1: 173,595,234	N22Y	probably damaging	Het
Kcnq1	T	A	7: 143,106,433		probably benign	Het
Kif7	T	A	7: 79,704,640	Q799L	probably benign	Het
Lmnb1	T	A	18: 56,729,384	L206*	probably null	Het
Lonp2	G	T	8: 86,713,373	G247V	probably damaging	Het
Ly75	T	C	2: 60,375,962	Y121C	probably damaging	Het
Mboat1	C	A	13: 30,224,526	T224K	probably benign	Het
Mcm9	T	C	10: 53,615,977	E416G	possibly damaging	Het
Mtnr1b	A	T	9: 15,862,797	I322N	probably damaging	Het
Nanog	G	A	6: 122,713,391	G227R	possibly damaging	Het
Nbn	T	C	4: 15,981,347	S480P	probably damaging	Het
Nek10	C	A	14: 14,865,633	L638M	probably benign	Het
Nelfcd	T	C	2: 174,426,818	V538A	probably damaging	Het
Olfr124	T	G	17: 37,805,421	I92S	probably damaging	Het
Olfr1447	T	A	19: 12,901,670	T37S	probably benign	Het
Olfr393	A	T	11: 73,847,919	S69T	probably benign	Het
Olfr69	T	C	7: 103,768,209	I63V	probably benign	Het
Phf24	G	A	4: 42,938,780		probably null	Het
Pigz	T	C	16: 31,945,710	S529P	probably damaging	Het
Pik3r5	A	G	11: 68,492,318	E321G	probably damaging	Het
Plcb3	G	A	19: 6,956,179	T926I	probably benign	Het
Pm20d2	G	A	4: 33,181,833	P257S	probably damaging	Het
Pon2	A	G	6: 5,289,057	V34A	probably benign	Het
Prkar2b	A	G	12: 32,060,856	F76S	possibly damaging	Het
Prpf31	G	A	7: 3,639,669	E414K	probably benign	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Setbp1	A	T	18: 78,859,240	L404Q	probably damaging	Het
Slc26a11	C	T	11: 119,374,828	A389V	probably damaging	Het
Slc2a1	A	T	4: 119,136,342	T459S	possibly damaging	Het
Spi1	T	C	2: 91,114,340	L135P	probably benign	Het
Sspo	T	C	6: 48,486,786	L3844P	possibly damaging	Het
Stxbp5	T	A	10: 9,800,028	T616S	probably benign	Het
Syde2	A	G	3: 146,007,141		probably null	Het
Synm	G	T	7: 67,734,938	A550D	possibly damaging	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tanc2	T	C	11: 105,896,547	V891A	possibly damaging	Het
Tlx1	A	T	19: 45,155,974	Q45L	probably damaging	Het
Tmem104	C	A	11: 115,205,523	Y191*	probably null	Het
Tmem17	A	C	11: 22,518,659	*199C	probably null	Het
Tns3	A	T	11: 8,492,578	M595K	possibly damaging	Het
Tyk2	A	G	9: 21,115,960	V538A	probably benign	Het
Unc80	A	G	1: 66,695,568	D3250G	possibly damaging	Het
Usp4	A	G	9: 108,360,123	H130R	possibly damaging	Het
Zfhx2	T	C	14: 55,065,208	Q1773R	probably benign	Het
Zfp790	A	G	7: 29,829,545	K552E	possibly damaging	Het
Zswim5	G	A	4: 116,950,909	R230Q	probably damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CTAGCAAAGCTGTCCTCTGG -3'
(R):5'- TCTGTTTGGAGAGGACCCAG -3'

Sequencing Primer
(F):5'- CTCTGGTGGCCTGGTCATAC -3'
(R):5'- AGGGGTCCGTGCAAGCTG -3'

Posted On

2017-06-26