Incidental Mutation 'R6025:Tns3'
ID479985
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
MMRRC Submission 044197-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R6025 (G1)
Quality Score212.009
Status Not validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8492578 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 595 (M595K)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020695
AA Change: M595K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: M595K

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dctn1 T A 6: 83,193,691 probably null Het
Dgkz T C 2: 91,945,910 T3A possibly damaging Het
Duoxa2 T C 2: 122,301,851 S249P possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fam71e2 T A 7: 4,758,144 D523V probably benign Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kcnq1 T A 7: 143,106,433 probably benign Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Lonp2 G T 8: 86,713,373 G247V probably damaging Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Stxbp5 T A 10: 9,800,028 T616S probably benign Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5472:Tns3 UTSW 11 8451092 missense probably benign
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGGCCCATTGCTGATGCC -3'
(R):5'- AGAACTCTCTCCTGTCTGATGG -3'

Sequencing Primer
(F):5'- GCTGATGCCTCTCTGAACAG -3'
(R):5'- TGCTGAAGATCATAATGGTGTCC -3'
Posted On2017-06-26