Incidental Mutation 'R6025:Tns3'
ID 479985
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms F830010I22Rik, Tens1, TEM6
MMRRC Submission 044197-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R6025 (G1)
Quality Score 212.009
Status Not validated
Chromosome 11
Chromosomal Location 8381652-8614681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8442578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 595 (M595K)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000020695
AA Change: M595K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: M595K

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,101,139 (GRCm39) probably null Het
Acvr1b C A 15: 101,092,856 (GRCm39) D166E probably benign Het
Adgra2 T C 8: 27,604,491 (GRCm39) I522T probably damaging Het
Adgre4 C T 17: 56,099,013 (GRCm39) S173L probably benign Het
Akap9 A T 5: 4,082,801 (GRCm39) Q1975L probably damaging Het
Ap3d1 T A 10: 80,546,298 (GRCm39) M965L probably benign Het
Brca2 CATA CA 5: 150,465,040 (GRCm39) probably null Het
Chd6 T C 2: 160,807,502 (GRCm39) N1904S probably benign Het
Clstn3 A T 6: 124,408,623 (GRCm39) S896R possibly damaging Het
Col6a3 T A 1: 90,755,824 (GRCm39) D155V probably damaging Het
Dct T C 14: 118,273,876 (GRCm39) T344A possibly damaging Het
Dctn1 T A 6: 83,170,673 (GRCm39) probably null Het
Dgkz T C 2: 91,776,255 (GRCm39) T3A possibly damaging Het
Duoxa2 T C 2: 122,132,332 (GRCm39) S249P possibly damaging Het
Ehbp1 A T 11: 22,189,156 (GRCm39) V82E probably damaging Het
Fcho1 A T 8: 72,165,217 (GRCm39) probably null Het
Garin5b T A 7: 4,761,143 (GRCm39) D523V probably benign Het
Ifi213 T A 1: 173,422,800 (GRCm39) N22Y probably damaging Het
Kcnq1 T A 7: 142,660,170 (GRCm39) probably benign Het
Kif7 T A 7: 79,354,388 (GRCm39) Q799L probably benign Het
Lmnb1 T A 18: 56,862,456 (GRCm39) L206* probably null Het
Lonp2 G T 8: 87,440,001 (GRCm39) G247V probably damaging Het
Ly75 T C 2: 60,206,306 (GRCm39) Y121C probably damaging Het
Mboat1 C A 13: 30,408,509 (GRCm39) T224K probably benign Het
Mcm9 T C 10: 53,492,073 (GRCm39) E416G possibly damaging Het
Mtnr1b A T 9: 15,774,093 (GRCm39) I322N probably damaging Het
Nanog G A 6: 122,690,350 (GRCm39) G227R possibly damaging Het
Nbn T C 4: 15,981,347 (GRCm39) S480P probably damaging Het
Nek10 C A 14: 14,865,633 (GRCm38) L638M probably benign Het
Nelfcd T C 2: 174,268,611 (GRCm39) V538A probably damaging Het
Or1e33 A T 11: 73,738,745 (GRCm39) S69T probably benign Het
Or2b4 T G 17: 38,116,312 (GRCm39) I92S probably damaging Het
Or52a5b T C 7: 103,417,416 (GRCm39) I63V probably benign Het
Or5b97 T A 19: 12,879,034 (GRCm39) T37S probably benign Het
Phf24 G A 4: 42,938,780 (GRCm39) probably null Het
Pigz T C 16: 31,764,528 (GRCm39) S529P probably damaging Het
Pik3r5 A G 11: 68,383,144 (GRCm39) E321G probably damaging Het
Plcb3 G A 19: 6,933,547 (GRCm39) T926I probably benign Het
Pm20d2 G A 4: 33,181,833 (GRCm39) P257S probably damaging Het
Pon2 A G 6: 5,289,057 (GRCm39) V34A probably benign Het
Prkar2b A G 12: 32,110,855 (GRCm39) F76S possibly damaging Het
Prpf31 G A 7: 3,642,668 (GRCm39) E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Setbp1 A T 18: 78,902,455 (GRCm39) L404Q probably damaging Het
Slc26a11 C T 11: 119,265,654 (GRCm39) A389V probably damaging Het
Slc2a1 A T 4: 118,993,539 (GRCm39) T459S possibly damaging Het
Spi1 T C 2: 90,944,685 (GRCm39) L135P probably benign Het
Sspo T C 6: 48,463,720 (GRCm39) L3844P possibly damaging Het
Stxbp5 T A 10: 9,675,772 (GRCm39) T616S probably benign Het
Syde2 A G 3: 145,712,896 (GRCm39) probably null Het
Synm G T 7: 67,384,686 (GRCm39) A550D possibly damaging Het
Tanc2 T C 11: 105,787,373 (GRCm39) V891A possibly damaging Het
Tanc2 G A 11: 105,758,543 (GRCm39) R768Q probably damaging Het
Tlx1 A T 19: 45,144,413 (GRCm39) Q45L probably damaging Het
Tmem104 C A 11: 115,096,349 (GRCm39) Y191* probably null Het
Tmem17 A C 11: 22,468,659 (GRCm39) *199C probably null Het
Tyk2 A G 9: 21,027,256 (GRCm39) V538A probably benign Het
Unc80 A G 1: 66,734,727 (GRCm39) D3250G possibly damaging Het
Usp4 A G 9: 108,237,322 (GRCm39) H130R possibly damaging Het
Zfhx2 T C 14: 55,302,665 (GRCm39) Q1773R probably benign Het
Zfp790 A G 7: 29,528,970 (GRCm39) K552E possibly damaging Het
Zswim5 G A 4: 116,808,106 (GRCm39) R230Q probably damaging Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8,401,066 (GRCm39) missense probably benign 0.42
IGL00822:Tns3 APN 11 8,393,976 (GRCm39) missense probably damaging 0.99
IGL01075:Tns3 APN 11 8,428,399 (GRCm39) missense probably benign 0.45
IGL01286:Tns3 APN 11 8,442,617 (GRCm39) missense probably benign 0.01
IGL01680:Tns3 APN 11 8,498,937 (GRCm39) missense probably damaging 1.00
IGL01687:Tns3 APN 11 8,442,798 (GRCm39) missense probably damaging 1.00
IGL01734:Tns3 APN 11 8,469,192 (GRCm39) splice site probably benign
IGL01844:Tns3 APN 11 8,387,177 (GRCm39) missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8,498,992 (GRCm39) nonsense probably null
IGL02137:Tns3 APN 11 8,442,578 (GRCm39) missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8,384,531 (GRCm39) missense probably damaging 1.00
IGL02623:Tns3 APN 11 8,387,141 (GRCm39) missense probably damaging 1.00
IGL02697:Tns3 APN 11 8,442,346 (GRCm39) missense probably benign 0.00
IGL02829:Tns3 APN 11 8,469,564 (GRCm39) missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8,442,149 (GRCm39) missense probably benign 0.38
R0020:Tns3 UTSW 11 8,495,227 (GRCm39) critical splice donor site probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0370:Tns3 UTSW 11 8,395,730 (GRCm39) missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8,395,703 (GRCm39) missense probably benign 0.07
R0410:Tns3 UTSW 11 8,385,852 (GRCm39) missense probably benign 0.02
R0496:Tns3 UTSW 11 8,497,262 (GRCm39) splice site probably benign
R0562:Tns3 UTSW 11 8,443,262 (GRCm39) missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8,443,121 (GRCm39) missense probably benign 0.04
R0736:Tns3 UTSW 11 8,469,474 (GRCm39) missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8,443,302 (GRCm39) missense probably damaging 1.00
R1367:Tns3 UTSW 11 8,398,704 (GRCm39) missense probably benign 0.01
R1386:Tns3 UTSW 11 8,468,261 (GRCm39) missense probably benign 0.02
R1975:Tns3 UTSW 11 8,385,738 (GRCm39) missense probably benign 0.04
R2205:Tns3 UTSW 11 8,481,719 (GRCm39) missense probably damaging 1.00
R2319:Tns3 UTSW 11 8,491,200 (GRCm39) missense probably damaging 1.00
R2830:Tns3 UTSW 11 8,385,870 (GRCm39) missense probably damaging 1.00
R3720:Tns3 UTSW 11 8,442,999 (GRCm39) missense probably damaging 1.00
R3765:Tns3 UTSW 11 8,401,133 (GRCm39) missense probably benign 0.00
R3817:Tns3 UTSW 11 8,384,619 (GRCm39) missense probably damaging 1.00
R4058:Tns3 UTSW 11 8,442,275 (GRCm39) missense probably damaging 1.00
R4599:Tns3 UTSW 11 8,481,747 (GRCm39) missense probably damaging 1.00
R4631:Tns3 UTSW 11 8,401,119 (GRCm39) missense probably benign 0.30
R4731:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4732:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4733:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R5472:Tns3 UTSW 11 8,401,092 (GRCm39) missense probably benign
R5749:Tns3 UTSW 11 8,401,177 (GRCm39) missense probably benign 0.01
R5807:Tns3 UTSW 11 8,443,211 (GRCm39) missense probably damaging 1.00
R5844:Tns3 UTSW 11 8,384,580 (GRCm39) missense probably damaging 1.00
R5942:Tns3 UTSW 11 8,385,860 (GRCm39) missense probably damaging 1.00
R5982:Tns3 UTSW 11 8,442,245 (GRCm39) missense probably damaging 0.99
R6266:Tns3 UTSW 11 8,442,987 (GRCm39) missense probably damaging 1.00
R6322:Tns3 UTSW 11 8,442,147 (GRCm39) missense probably benign 0.01
R6536:Tns3 UTSW 11 8,384,531 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,058 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,057 (GRCm39) missense probably damaging 1.00
R6864:Tns3 UTSW 11 8,443,196 (GRCm39) missense probably damaging 1.00
R6897:Tns3 UTSW 11 8,481,743 (GRCm39) missense probably damaging 1.00
R7108:Tns3 UTSW 11 8,387,251 (GRCm39) missense probably benign 0.00
R7443:Tns3 UTSW 11 8,401,442 (GRCm39) missense probably benign 0.01
R7459:Tns3 UTSW 11 8,442,793 (GRCm39) missense probably benign 0.16
R7474:Tns3 UTSW 11 8,480,894 (GRCm39) missense probably damaging 1.00
R7576:Tns3 UTSW 11 8,491,192 (GRCm39) missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8,442,701 (GRCm39) missense probably benign 0.01
R8055:Tns3 UTSW 11 8,495,343 (GRCm39) missense probably damaging 1.00
R8057:Tns3 UTSW 11 8,442,773 (GRCm39) missense probably benign
R8077:Tns3 UTSW 11 8,395,667 (GRCm39) missense probably damaging 1.00
R8518:Tns3 UTSW 11 8,442,971 (GRCm39) missense probably damaging 0.96
R8523:Tns3 UTSW 11 8,398,779 (GRCm39) missense probably damaging 1.00
R8790:Tns3 UTSW 11 8,468,273 (GRCm39) missense probably damaging 0.99
R9228:Tns3 UTSW 11 8,400,094 (GRCm39) missense probably damaging 1.00
R9374:Tns3 UTSW 11 8,442,606 (GRCm39) missense probably damaging 1.00
R9476:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9510:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9594:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9596:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8,401,146 (GRCm39) missense probably benign 0.00
T0975:Tns3 UTSW 11 8,499,100 (GRCm39) start gained probably benign
T0975:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,401,224 (GRCm39) missense probably benign 0.00
Z1177:Tns3 UTSW 11 8,401,014 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGGCCCATTGCTGATGCC -3'
(R):5'- AGAACTCTCTCCTGTCTGATGG -3'

Sequencing Primer
(F):5'- GCTGATGCCTCTCTGAACAG -3'
(R):5'- TGCTGAAGATCATAATGGTGTCC -3'
Posted On 2017-06-26