Incidental Mutation 'R6026:Plxna2'
ID480014
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6026 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 194799814 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1465 (I1465V)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027952
AA Change: I1465V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: I1465V

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124785
Meta Mutation Damage Score 0.2268 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fancd2 T C 6: 113,551,770 V380A possibly damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194643871 missense probably benign 0.25
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGCTTTGGAAACAGCATGGG -3'
(R):5'- CAGATTGGTCCCTAAGCCTC -3'

Sequencing Primer
(F):5'- GGACCTGTTCTTCAAAAACTGGG -3'
(R):5'- CCTAAGCCTCTTTTTGATAAATGGC -3'
Posted On2017-06-26