Incidental Mutation 'R6026:Fancd2'
ID480037
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission 044198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6026 (G1)
Quality Score208.009
Status Validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113551770 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 380 (V380A)
Ref Sequence ENSEMBL: ENSMUSP00000144928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036340
AA Change: V380A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: V380A

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123738
SMART Domains Protein: ENSMUSP00000122091
Gene: ENSMUSG00000034023

DomainStartEndE-ValueType
Pfam:FancD2 1 246 5.7e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142453
Predicted Effect possibly damaging
Transcript: ENSMUST00000204827
AA Change: V380A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: V380A

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,755 D187G probably benign Het
4933421I07Rik A T 7: 42,446,284 M180K probably benign Het
Aatk T C 11: 120,012,364 H345R possibly damaging Het
Abcc8 T C 7: 46,167,000 T239A probably benign Het
Abcf3 A G 16: 20,550,570 E234G probably damaging Het
Actrt2 T C 4: 154,666,590 D363G possibly damaging Het
Adam1a A T 5: 121,519,362 C623S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Barhl2 T A 5: 106,455,608 K228N probably benign Het
Blvrb A G 7: 27,462,690 H153R probably damaging Het
Capn9 A G 8: 124,605,862 D480G probably damaging Het
Cct3 T C 3: 88,311,722 I182T possibly damaging Het
Clasp2 A G 9: 113,911,578 N1208D probably benign Het
Col26a1 A G 5: 136,847,500 C89R probably damaging Het
Cops4 T A 5: 100,542,328 probably benign Het
Cpox T A 16: 58,670,935 W170R probably damaging Het
Ddx27 A G 2: 167,033,640 K656E probably benign Het
Eif4e T C 3: 138,550,900 I66T probably damaging Het
Ercc3 T C 18: 32,245,921 probably null Het
Esp38 G A 17: 39,955,141 C47Y probably damaging Het
Fbxw7 T A 3: 84,952,641 probably null Het
Fryl T G 5: 73,099,997 R736S probably benign Het
Gad2 G A 2: 22,623,736 V62M probably benign Het
Gigyf2 A G 1: 87,440,732 T1045A probably damaging Het
Gm13090 T A 4: 151,090,700 L78* probably null Het
Gm19410 G A 8: 35,812,426 S1815N probably benign Het
Gm28051 A T 12: 102,720,185 L72Q unknown Het
Gm44511 T C 6: 128,820,277 T83A possibly damaging Het
Grk2 C T 19: 4,290,783 V246I probably damaging Het
Grm7 C T 6: 111,501,539 Q62* probably null Het
Gsdmc3 T A 15: 63,866,751 E154V probably damaging Het
Gstz1 A C 12: 87,160,174 Q114P probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hhip A T 8: 79,972,440 C666S probably damaging Het
Hif1a A C 12: 73,932,281 H193P probably damaging Het
Hyal2 A G 9: 107,572,199 T385A probably benign Het
Ihh T C 1: 74,946,727 T200A probably benign Het
Iqgap3 T A 3: 88,090,171 V218E probably damaging Het
Lct A G 1: 128,300,018 I1246T probably benign Het
Lmo7 T C 14: 101,880,990 V217A probably benign Het
Lrp1 C T 10: 127,573,403 D1616N probably damaging Het
Lrrfip2 A T 9: 111,214,171 T165S probably damaging Het
Morc2b A G 17: 33,137,983 Y272H possibly damaging Het
Muc16 A G 9: 18,659,858 M455T unknown Het
Ncapg2 A T 12: 116,443,021 D939V possibly damaging Het
Ncbp3 T C 11: 73,067,722 V236A probably benign Het
Obscn T A 11: 59,067,090 T3595S probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr410 T A 11: 74,335,088 I48F probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Pdzrn3 A C 6: 101,362,144 C269G probably benign Het
Pear1 T A 3: 87,756,913 N278Y probably damaging Het
Phb C T 11: 95,671,419 R41* probably null Het
Pikfyve T C 1: 65,272,697 V2031A probably damaging Het
Plxna2 A G 1: 194,799,814 I1465V probably damaging Het
Ppp6r2 A G 15: 89,282,910 N776S probably benign Het
Prkce A T 17: 86,493,230 E358V probably benign Het
Prl5a1 A T 13: 28,151,264 I219F probably benign Het
Prss3 T C 6: 41,377,554 probably null Het
Ptprc A T 1: 138,071,249 M858K probably damaging Het
Retreg3 T C 11: 101,106,400 T85A probably damaging Het
Rfc2 T A 5: 134,595,331 C265S probably damaging Het
Smarcd1 G T 15: 99,705,738 V256L probably damaging Het
Stat5a T C 11: 100,880,316 F574L probably damaging Het
Tcirg1 T C 19: 3,897,487 H624R probably benign Het
Tcstv1 C A 13: 119,894,451 probably benign Het
Tenm2 C T 11: 36,072,729 probably null Het
Tomm40 A G 7: 19,710,964 V164A probably benign Het
Txnl4a T C 18: 80,207,267 V26A probably damaging Het
Ugt2a3 A T 5: 87,336,477 F229L probably benign Het
Utp20 T C 10: 88,768,679 T1785A probably benign Het
Vmn1r22 T A 6: 57,900,405 I196L probably benign Het
Zfp652 T G 11: 95,749,962 C238G possibly damaging Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 splice site probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 splice site probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
R7489:Fancd2 UTSW 6 113564304 missense probably benign
R7501:Fancd2 UTSW 6 113548403 missense possibly damaging 0.95
R7504:Fancd2 UTSW 6 113545038 missense probably damaging 1.00
R7992:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R8027:Fancd2 UTSW 6 113546622 missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113568226 missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113572570 missense probably benign 0.00
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113545025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTGTTTAAAAGCGGGTTAGC -3'
(R):5'- GGCATGTCTCCACCTGCAC -3'

Sequencing Primer
(F):5'- GGCTATACAGAGAAACCCTGTGTC -3'
(R):5'- GCACCCACTACTTCCCGTAC -3'
Posted On2017-06-26