Incidental Mutation 'R6027:Lypla1'
ID480083
Institutional Source Beutler Lab
Gene Symbol Lypla1
Ensembl Gene ENSMUSG00000025903
Gene Namelysophospholipase 1
SynonymsPla1a
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location4807788-4848410 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 4837076 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027036] [ENSMUST00000115529] [ENSMUST00000115529] [ENSMUST00000119612] [ENSMUST00000131119] [ENSMUST00000131119] [ENSMUST00000134384] [ENSMUST00000137887] [ENSMUST00000137887] [ENSMUST00000150971] [ENSMUST00000150971] [ENSMUST00000155020]
Predicted Effect probably null
Transcript: ENSMUST00000027036
SMART Domains Protein: ENSMUSP00000027036
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 226 2.5e-92 PFAM
Pfam:Abhydrolase_5 23 209 4.3e-14 PFAM
Pfam:Abhydrolase_3 82 170 2.6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115529
SMART Domains Protein: ENSMUSP00000111191
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 125 1.5e-49 PFAM
Pfam:Abhydrolase_2 122 192 2.2e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115529
SMART Domains Protein: ENSMUSP00000111191
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 125 1.5e-49 PFAM
Pfam:Abhydrolase_2 122 192 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119612
SMART Domains Protein: ENSMUSP00000137647
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 92 1.1e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131119
SMART Domains Protein: ENSMUSP00000118453
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 1 142 8.1e-56 PFAM
Pfam:Abhydrolase_5 10 141 7.8e-11 PFAM
Pfam:Abhydrolase_6 11 139 9.2e-8 PFAM
Pfam:Abhydrolase_3 20 139 4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131119
SMART Domains Protein: ENSMUSP00000118453
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 1 142 8.1e-56 PFAM
Pfam:Abhydrolase_5 10 141 7.8e-11 PFAM
Pfam:Abhydrolase_6 11 139 9.2e-8 PFAM
Pfam:Abhydrolase_3 20 139 4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134384
SMART Domains Protein: ENSMUSP00000137104
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 224 5.6e-85 PFAM
Pfam:Abhydrolase_5 23 209 4e-14 PFAM
Pfam:Abhydrolase_6 24 160 2.5e-10 PFAM
Pfam:Abhydrolase_3 85 195 2.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137887
SMART Domains Protein: ENSMUSP00000119456
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 142 5.6e-48 PFAM
Pfam:Abhydrolase_5 23 141 9.3e-10 PFAM
Pfam:Abhydrolase_6 24 141 7.2e-12 PFAM
Pfam:Abhydrolase_3 62 140 2.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137887
SMART Domains Protein: ENSMUSP00000119456
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 142 5.6e-48 PFAM
Pfam:Abhydrolase_5 23 141 9.3e-10 PFAM
Pfam:Abhydrolase_6 24 141 7.2e-12 PFAM
Pfam:Abhydrolase_3 62 140 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141278
Predicted Effect probably null
Transcript: ENSMUST00000150971
SMART Domains Protein: ENSMUSP00000137248
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 215 1.3e-84 PFAM
Pfam:Abhydrolase_5 23 209 4.4e-14 PFAM
Pfam:Abhydrolase_6 24 160 3.6e-10 PFAM
Pfam:Abhydrolase_3 85 195 1.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150971
SMART Domains Protein: ENSMUSP00000137248
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 215 1.3e-84 PFAM
Pfam:Abhydrolase_5 23 209 4.4e-14 PFAM
Pfam:Abhydrolase_6 24 160 3.6e-10 PFAM
Pfam:Abhydrolase_3 85 195 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155020
SMART Domains Protein: ENSMUSP00000136108
Gene: ENSMUSG00000104217

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Lypla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Lypla1 APN 1 4828587 missense probably damaging 1.00
IGL01571:Lypla1 APN 1 4844988 missense probably benign 0.15
IGL01592:Lypla1 APN 1 4828651 critical splice donor site probably null
IGL01865:Lypla1 APN 1 4837036 missense probably damaging 0.96
IGL02442:Lypla1 APN 1 4832387 splice site probably benign
IGL03005:Lypla1 APN 1 4832390 splice site probably benign
R0095:Lypla1 UTSW 1 4830327 splice site probably benign
R2278:Lypla1 UTSW 1 4841098 splice site probably null
R3766:Lypla1 UTSW 1 4840978 missense probably benign 0.04
R5805:Lypla1 UTSW 1 4830294 missense possibly damaging 0.54
R6014:Lypla1 UTSW 1 4808371 splice site probably null
R6842:Lypla1 UTSW 1 4832340 missense probably benign 0.14
R7285:Lypla1 UTSW 1 4841098 missense probably benign
R7564:Lypla1 UTSW 1 4808367 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGTAGAGTCTGAGGAGTC -3'
(R):5'- GGGCAGAAATTATTTCCAGTCC -3'

Sequencing Primer
(F):5'- GAATTGAACTCAGGACCTCTGGATC -3'
(R):5'- GGCAGAAATTATTTCCAGTCCAATCC -3'
Posted On2017-06-26