Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Aspm'

480090

Institutional Source

Beutler Lab

Gene Symbol

Aspm

Ensembl Gene

ENSMUSG00000033952

Gene Name

abnormal spindle microtubule assembly

Synonyms

Aspm, Sha1, MCPH5, D330028K02Rik, Calmbp1

MMRRC Submission

044199-MU

Accession Numbers

Genbank: NM_009791; MGI: 1334448

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139454772-139494091 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 139463056 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 693 (V693G)

Ref Sequence

ENSEMBL: ENSMUSP00000142880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053364
AA Change: V693G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: V693G

Domain	Start	End	E-Value	Type
Pfam:ASH	29	126	8.9e-35	PFAM
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	2.41e-4	SMART
IQ	1360	1382	2.12e1	SMART
IQ	1387	1408	7.61e1	SMART
IQ	1409	1431	6.97e0	SMART
IQ	1432	1452	1.44e1	SMART
IQ	1453	1475	1.15e-1	SMART
IQ	1476	1495	1.66e2	SMART
IQ	1503	1525	1.65e-2	SMART
IQ	1526	1548	1.32e1	SMART
IQ	1549	1571	1.48e1	SMART
IQ	1572	1594	2.5e1	SMART
IQ	1599	1621	2.58e-4	SMART
IQ	1622	1644	6.7e-3	SMART
IQ	1645	1667	4.25e1	SMART
IQ	1668	1694	1.03e2	SMART
IQ	1695	1717	2.33e-2	SMART
IQ	1718	1740	7.79e0	SMART
IQ	1741	1763	1.57e2	SMART
IQ	1768	1790	2.68e-2	SMART
IQ	1791	1813	5.83e-3	SMART
IQ	1814	1836	5.93e1	SMART
IQ	1841	1863	1.92e-3	SMART
IQ	1864	1886	3.79e-2	SMART
IQ	1914	1936	4.11e0	SMART
IQ	1937	1959	1.87e-1	SMART
IQ	1960	1982	6.27e1	SMART
IQ	1987	2009	8.25e-3	SMART
IQ	2010	2032	5.73e0	SMART
IQ	2060	2082	1.39e0	SMART
IQ	2083	2105	4.62e1	SMART
IQ	2133	2155	5.58e0	SMART
IQ	2156	2178	7.07e-2	SMART
IQ	2206	2228	1.18e-3	SMART
IQ	2229	2251	4.59e0	SMART
IQ	2278	2300	1.85e-5	SMART
IQ	2301	2323	8.13e-2	SMART
IQ	2342	2364	9.62e-4	SMART
IQ	2365	2387	4.12e-3	SMART
IQ	2415	2437	7.58e-2	SMART
IQ	2438	2460	2.6e0	SMART
IQ	2490	2512	1.68e-3	SMART
IQ	2513	2535	8.51e1	SMART
IQ	2560	2582	2.14e-1	SMART
IQ	2601	2623	8.46e0	SMART
IQ	2647	2669	1.15e1	SMART
IQ	2673	2695	1.95e-4	SMART
IQ	2696	2718	4.13e1	SMART
IQ	2723	2745	1.02e-2	SMART
IQ	2761	2783	3.14e2	SMART
IQ	2784	2806	1e1	SMART
IQ	2825	2847	2.43e0	SMART
IQ	2848	2870	4.6e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199998

Predicted Effect

probably damaging
Transcript: ENSMUST00000200083
AA Change: V693G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952
AA Change: V693G

Domain	Start	End	E-Value	Type
low complexity region	855	861	N/A	INTRINSIC
CH	890	1022	2.04e0	SMART
CH	1080	1224	5.56e-9	SMART
IQ	1233	1255	7.57e0	SMART
IQ	1259	1281	1.12e1	SMART
IQ	1282	1304	3.73e-1	SMART
IQ	1314	1336	1.25e1	SMART
IQ	1337	1358	2.96e1	SMART
IQ	1382	1404	1.15e1	SMART
IQ	1408	1430	1.95e-4	SMART
IQ	1431	1453	4.13e1	SMART
IQ	1458	1480	1.02e-2	SMART
IQ	1496	1518	3.14e2	SMART
IQ	1519	1541	1e1	SMART
IQ	1560	1582	2.43e0	SMART
IQ	1583	1605	4.6e-1	SMART

Meta Mutation Damage Score

0.2085

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Aspm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Aspm	APN	1	139478691	missense	probably damaging	1.00
IGL00594:Aspm	APN	1	139487422	splice site	probably benign
IGL00808:Aspm	APN	1	139461476	missense	probably benign	0.03
IGL00897:Aspm	APN	1	139477407	missense	probably damaging	0.98
IGL01024:Aspm	APN	1	139478124	missense	possibly damaging	0.66
IGL01410:Aspm	APN	1	139482444	missense	probably benign	0.25
IGL01588:Aspm	APN	1	139478162	missense	probably benign	0.11
IGL01610:Aspm	APN	1	139489670	nonsense	probably null
IGL01633:Aspm	APN	1	139480836	missense	possibly damaging	0.93
IGL01982:Aspm	APN	1	139491588	missense	probably benign	0.12
IGL02429:Aspm	APN	1	139479810	missense	probably benign	0.27
IGL02468:Aspm	APN	1	139480950	missense	probably damaging	1.00
IGL02519:Aspm	APN	1	139461927	splice site	probably benign
IGL02526:Aspm	APN	1	139489719	missense	probably benign	0.03
IGL02716:Aspm	APN	1	139479687	missense	probably damaging	1.00
IGL02876:Aspm	APN	1	139473653	missense	probably damaging	1.00
IGL02953:Aspm	APN	1	139457419	missense	probably benign	0.01
IGL03275:Aspm	APN	1	139487295	missense	probably damaging	1.00
Stemware	UTSW	1	139477459	nonsense	probably null
3-1:Aspm	UTSW	1	139457541	missense	probably benign
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0016:Aspm	UTSW	1	139479544	missense	probably benign	0.01
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0106:Aspm	UTSW	1	139476876	missense	probably benign	0.02
R0140:Aspm	UTSW	1	139480641	missense	probably benign	0.00
R0195:Aspm	UTSW	1	139479135	missense	probably damaging	1.00
R0217:Aspm	UTSW	1	139457880	missense	possibly damaging	0.46
R0276:Aspm	UTSW	1	139478471	missense	possibly damaging	0.95
R0309:Aspm	UTSW	1	139482511	splice site	probably benign
R0466:Aspm	UTSW	1	139477901	missense	probably damaging	1.00
R0520:Aspm	UTSW	1	139478820	missense	possibly damaging	0.51
R0615:Aspm	UTSW	1	139487289	missense	probably damaging	1.00
R0626:Aspm	UTSW	1	139491601	missense	probably damaging	1.00
R0660:Aspm	UTSW	1	139457764	missense	probably benign	0.03
R0751:Aspm	UTSW	1	139456898	splice site	probably benign
R0830:Aspm	UTSW	1	139474254	missense	probably damaging	0.99
R1109:Aspm	UTSW	1	139456758	missense	probably damaging	0.99
R1114:Aspm	UTSW	1	139461924	splice site	probably benign
R1130:Aspm	UTSW	1	139477834	missense	possibly damaging	0.90
R1298:Aspm	UTSW	1	139457419	missense	probably benign	0.01
R1386:Aspm	UTSW	1	139457623	missense	probably benign	0.03
R1386:Aspm	UTSW	1	139478972	missense	possibly damaging	0.80
R1557:Aspm	UTSW	1	139468668	missense	probably benign	0.01
R1625:Aspm	UTSW	1	139481039	missense	probably benign	0.01
R1728:Aspm	UTSW	1	139473574	missense	probably benign
R1729:Aspm	UTSW	1	139473574	missense	probably benign
R1730:Aspm	UTSW	1	139473574	missense	probably benign
R1733:Aspm	UTSW	1	139457117	missense	probably benign	0.27
R1739:Aspm	UTSW	1	139473574	missense	probably benign
R1762:Aspm	UTSW	1	139473574	missense	probably benign
R1783:Aspm	UTSW	1	139473574	missense	probably benign
R1784:Aspm	UTSW	1	139473574	missense	probably benign
R1785:Aspm	UTSW	1	139473574	missense	probably benign
R1793:Aspm	UTSW	1	139457341	missense	probably benign	0.00
R1893:Aspm	UTSW	1	139479867	missense	probably damaging	1.00
R1911:Aspm	UTSW	1	139478094	missense	probably benign	0.06
R2103:Aspm	UTSW	1	139491665	missense	probably damaging	0.99
R2128:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2129:Aspm	UTSW	1	139457635	missense	probably benign	0.14
R2239:Aspm	UTSW	1	139456846	missense	possibly damaging	0.67
R2352:Aspm	UTSW	1	139457562	missense	probably benign	0.02
R2353:Aspm	UTSW	1	139477697	missense	probably damaging	1.00
R2380:Aspm	UTSW	1	139479348	missense	probably damaging	1.00
R2413:Aspm	UTSW	1	139477757	missense	probably damaging	1.00
R2421:Aspm	UTSW	1	139488487	missense	possibly damaging	0.49
R3607:Aspm	UTSW	1	139480668	missense	probably benign	0.13
R3711:Aspm	UTSW	1	139458100	missense	probably benign	0.17
R3718:Aspm	UTSW	1	139480889	missense	probably benign	0.09
R3718:Aspm	UTSW	1	139490427	missense	probably benign	0.31
R3741:Aspm	UTSW	1	139478619	missense	possibly damaging	0.47
R3788:Aspm	UTSW	1	139463203	missense	probably damaging	1.00
R3838:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3839:Aspm	UTSW	1	139478054	missense	probably benign	0.24
R3849:Aspm	UTSW	1	139458286	missense	probably benign	0.21
R4075:Aspm	UTSW	1	139474285	missense	probably damaging	1.00
R4080:Aspm	UTSW	1	139470755	missense	probably damaging	1.00
R4463:Aspm	UTSW	1	139455010	missense	possibly damaging	0.95
R4537:Aspm	UTSW	1	139474303	missense	probably benign	0.01
R4547:Aspm	UTSW	1	139478187	missense	possibly damaging	0.75
R4573:Aspm	UTSW	1	139479507	missense	probably damaging	0.98
R4680:Aspm	UTSW	1	139480671	missense	probably benign	0.05
R4807:Aspm	UTSW	1	139477919	missense	probably damaging	1.00
R4840:Aspm	UTSW	1	139470531	missense	possibly damaging	0.83
R4854:Aspm	UTSW	1	139478072	nonsense	probably null
R4859:Aspm	UTSW	1	139469393	missense	probably damaging	1.00
R4893:Aspm	UTSW	1	139489839	critical splice donor site	probably null
R4910:Aspm	UTSW	1	139491543	missense	probably damaging	1.00
R4953:Aspm	UTSW	1	139471734	missense	probably benign	0.00
R4974:Aspm	UTSW	1	139478010	missense	probably benign	0.03
R4981:Aspm	UTSW	1	139470760	splice site	probably null
R5082:Aspm	UTSW	1	139478676	nonsense	probably null
R5223:Aspm	UTSW	1	139478334	missense	probably damaging	1.00
R5268:Aspm	UTSW	1	139464295	missense	probably damaging	1.00
R5371:Aspm	UTSW	1	139470541	nonsense	probably null
R5377:Aspm	UTSW	1	139457483	missense	probably damaging	0.96
R5377:Aspm	UTSW	1	139470395	splice site	probably null
R5481:Aspm	UTSW	1	139457061	missense	possibly damaging	0.85
R5513:Aspm	UTSW	1	139482398	missense	probably damaging	1.00
R5578:Aspm	UTSW	1	139470717	missense	probably damaging	1.00
R5649:Aspm	UTSW	1	139479669	missense	probably benign
R5685:Aspm	UTSW	1	139487288	missense	probably benign	0.10
R5695:Aspm	UTSW	1	139479669	missense	probably benign
R5766:Aspm	UTSW	1	139479002	missense	probably damaging	0.99
R5964:Aspm	UTSW	1	139455227	intron	probably benign
R5993:Aspm	UTSW	1	139479531	missense	probably benign	0.28
R6029:Aspm	UTSW	1	139480990	missense	possibly damaging	0.83
R6102:Aspm	UTSW	1	139477459	nonsense	probably null
R6188:Aspm	UTSW	1	139479239	missense	possibly damaging	0.79
R6257:Aspm	UTSW	1	139482053	splice site	probably null
R6433:Aspm	UTSW	1	139473683	missense	probably damaging	1.00
R6682:Aspm	UTSW	1	139457722	missense	possibly damaging	0.67
R6763:Aspm	UTSW	1	139470517	missense	possibly damaging	0.64
R6798:Aspm	UTSW	1	139468685	missense	possibly damaging	0.66
R6815:Aspm	UTSW	1	139480142	missense	probably benign	0.04
R6854:Aspm	UTSW	1	139463182	missense	possibly damaging	0.90
R6928:Aspm	UTSW	1	139480206	nonsense	probably null
R6943:Aspm	UTSW	1	139480542	missense	probably damaging	1.00
R6979:Aspm	UTSW	1	139480485	missense	probably damaging	1.00
R6998:Aspm	UTSW	1	139469472	missense	probably damaging	1.00
R7126:Aspm	UTSW	1	139480803	missense	probably benign	0.27
R7237:Aspm	UTSW	1	139477929	missense	possibly damaging	0.81
R7240:Aspm	UTSW	1	139478651	nonsense	probably null
R7272:Aspm	UTSW	1	139458328	missense	probably benign	0.14
R7427:Aspm	UTSW	1	139457616	missense	probably benign	0.01
R7519:Aspm	UTSW	1	139490336	missense	possibly damaging	0.53
R7776:Aspm	UTSW	1	139479846	missense	possibly damaging	0.85
R7875:Aspm	UTSW	1	139455134	missense	probably benign	0.02
R7883:Aspm	UTSW	1	139478667	missense	possibly damaging	0.47
R7964:Aspm	UTSW	1	139480686	missense	probably damaging	1.00
R8012:Aspm	UTSW	1	139457464	missense	probably benign	0.03
R8029:Aspm	UTSW	1	139471632	missense	probably benign	0.00
R8233:Aspm	UTSW	1	139457304	missense	probably benign	0.28
R8277:Aspm	UTSW	1	139455010	missense	probably damaging	1.00
R8345:Aspm	UTSW	1	139464273	nonsense	probably null
R8491:Aspm	UTSW	1	139457695	missense	probably damaging	0.98
R8511:Aspm	UTSW	1	139457308	missense	probably damaging	1.00
R8557:Aspm	UTSW	1	139456756	missense	probably benign	0.01
R8927:Aspm	UTSW	1	139490387	nonsense	probably null
R8928:Aspm	UTSW	1	139490387	nonsense	probably null
R8950:Aspm	UTSW	1	139478952	missense	probably damaging	1.00
R9033:Aspm	UTSW	1	139478127	missense	probably damaging	1.00
R9083:Aspm	UTSW	1	139493698	missense	possibly damaging	0.70
R9133:Aspm	UTSW	1	139491528	missense	probably damaging	1.00
R9160:Aspm	UTSW	1	139490124	missense	probably damaging	1.00
R9179:Aspm	UTSW	1	139476715	missense	probably damaging	1.00
R9265:Aspm	UTSW	1	139461444	missense	probably benign	0.24
R9400:Aspm	UTSW	1	139479903	missense	probably damaging	1.00
R9419:Aspm	UTSW	1	139457185	missense	probably benign	0.29
X0063:Aspm	UTSW	1	139458090	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGATGACAAGAAAAGCTTACCTTG -3'
(R):5'- TTTTCGAACAAGTAGCCGCC -3'

Sequencing Primer
(F):5'- GACAAGAAAAGCTTACCTTGTTAGGC -3'
(R):5'- AGTAGCCGCCCAACTTCAATTTC -3'

Posted On

2017-06-26