Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Olfr1085'

480092

Institutional Source

Beutler Lab

Gene Symbol

Olfr1085

Ensembl Gene

ENSMUSG00000075176

Gene Name

olfactory receptor 1085

Synonyms

GA_x6K02T2Q125-48147264-48146323, MOR191-1

MMRRC Submission

044199-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86653665-86662019 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 86657804 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 218 (Y218S)

Ref Sequence

ENSEMBL: ENSMUSP00000150955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099879] [ENSMUST00000213279] [ENSMUST00000214566]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099879
AA Change: Y218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097464
Gene: ENSMUSG00000075176
AA Change: Y218S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	4.6e-49	PFAM
Pfam:7tm_1	41	290	1.1e-18	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213279
AA Change: Y218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214566
AA Change: Y218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Olfr1085

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Olfr1085	APN	2	86657726	missense	probably damaging	0.98
IGL01137:Olfr1085	APN	2	86657711	missense	possibly damaging	0.92
IGL01329:Olfr1085	APN	2	86658207	missense	probably benign	0.31
IGL01398:Olfr1085	APN	2	86657688	missense	probably damaging	1.00
IGL02248:Olfr1085	APN	2	86657717	missense	probably damaging	1.00
IGL02699:Olfr1085	APN	2	86658347	missense	probably benign	0.34
IGL02818:Olfr1085	APN	2	86657784	missense	probably damaging	1.00
IGL03095:Olfr1085	APN	2	86658431	missense	possibly damaging	0.50
IGL03218:Olfr1085	APN	2	86658359	missense	probably benign	0.32
R0121:Olfr1085	UTSW	2	86657819	missense	probably benign	0.42
R0546:Olfr1085	UTSW	2	86657891	missense	possibly damaging	0.91
R0583:Olfr1085	UTSW	2	86658360	missense	probably benign	0.20
R0980:Olfr1085	UTSW	2	86657865	missense	probably benign	0.39
R2067:Olfr1085	UTSW	2	86658437	missense	probably damaging	1.00
R2111:Olfr1085	UTSW	2	86658437	missense	probably damaging	1.00
R3760:Olfr1085	UTSW	2	86657888	missense	possibly damaging	0.91
R4530:Olfr1085	UTSW	2	86657561	missense	probably benign	0.00
R4809:Olfr1085	UTSW	2	86657685	missense	possibly damaging	0.95
R5940:Olfr1085	UTSW	2	86658050	missense	probably damaging	0.98
R6417:Olfr1085	UTSW	2	86658166	nonsense	probably null
R6420:Olfr1085	UTSW	2	86658166	nonsense	probably null
R6619:Olfr1085	UTSW	2	86658062	missense	probably damaging	1.00
R6762:Olfr1085	UTSW	2	86657844	missense	probably benign	0.22
R6946:Olfr1085	UTSW	2	86657588	missense	probably damaging	1.00
R7673:Olfr1085	UTSW	2	86657726	missense	probably damaging	1.00
R7718:Olfr1085	UTSW	2	86658029	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GGATTCAACATTGGGATAACAAGTGTG -3'
(R):5'- GGCGGTCCCATATATCTACAG -3'

Sequencing Primer
(F):5'- ACAAGTGTGTAAAATATGGAAGACAC -3'
(R):5'- GTGGCTACAATATCATCAATC -3'

Posted On

2017-06-26