Incidental Mutation 'R6027:Olfr1085'
ID480092
Institutional Source Beutler Lab
Gene Symbol Olfr1085
Ensembl Gene ENSMUSG00000075176
Gene Nameolfactory receptor 1085
SynonymsGA_x6K02T2Q125-48147264-48146323, MOR191-1
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86653665-86662019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86657804 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 218 (Y218S)
Ref Sequence ENSEMBL: ENSMUSP00000150955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099879] [ENSMUST00000213279] [ENSMUST00000214566]
Predicted Effect probably damaging
Transcript: ENSMUST00000099879
AA Change: Y218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097464
Gene: ENSMUSG00000075176
AA Change: Y218S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.6e-49 PFAM
Pfam:7tm_1 41 290 1.1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213279
AA Change: Y218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214566
AA Change: Y218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Olfr1085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Olfr1085 APN 2 86657726 missense probably damaging 0.98
IGL01137:Olfr1085 APN 2 86657711 missense possibly damaging 0.92
IGL01329:Olfr1085 APN 2 86658207 missense probably benign 0.31
IGL01398:Olfr1085 APN 2 86657688 missense probably damaging 1.00
IGL02248:Olfr1085 APN 2 86657717 missense probably damaging 1.00
IGL02699:Olfr1085 APN 2 86658347 missense probably benign 0.34
IGL02818:Olfr1085 APN 2 86657784 missense probably damaging 1.00
IGL03095:Olfr1085 APN 2 86658431 missense possibly damaging 0.50
IGL03218:Olfr1085 APN 2 86658359 missense probably benign 0.32
R0121:Olfr1085 UTSW 2 86657819 missense probably benign 0.42
R0546:Olfr1085 UTSW 2 86657891 missense possibly damaging 0.91
R0583:Olfr1085 UTSW 2 86658360 missense probably benign 0.20
R0980:Olfr1085 UTSW 2 86657865 missense probably benign 0.39
R2067:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R2111:Olfr1085 UTSW 2 86658437 missense probably damaging 1.00
R3760:Olfr1085 UTSW 2 86657888 missense possibly damaging 0.91
R4530:Olfr1085 UTSW 2 86657561 missense probably benign 0.00
R4809:Olfr1085 UTSW 2 86657685 missense possibly damaging 0.95
R5940:Olfr1085 UTSW 2 86658050 missense probably damaging 0.98
R6417:Olfr1085 UTSW 2 86658166 nonsense probably null
R6420:Olfr1085 UTSW 2 86658166 nonsense probably null
R6619:Olfr1085 UTSW 2 86658062 missense probably damaging 1.00
R6762:Olfr1085 UTSW 2 86657844 missense probably benign 0.22
R6946:Olfr1085 UTSW 2 86657588 missense probably damaging 1.00
R7673:Olfr1085 UTSW 2 86657726 missense probably damaging 1.00
R7718:Olfr1085 UTSW 2 86658029 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GGATTCAACATTGGGATAACAAGTGTG -3'
(R):5'- GGCGGTCCCATATATCTACAG -3'

Sequencing Primer
(F):5'- ACAAGTGTGTAAAATATGGAAGACAC -3'
(R):5'- GTGGCTACAATATCATCAATC -3'
Posted On2017-06-26