Incidental Mutation 'R6027:Ash1l'
ID480096
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene NameASH1 like histone lysine methyltransferase
Synonymschromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
MMRRC Submission 044199-MU
Accession Numbers

Genbank: NM_138679; MGI: 2183158

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88950622-89079375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88985019 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1402 (Y1402H)
Ref Sequence ENSEMBL: ENSMUSP00000140251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
Predicted Effect probably damaging
Transcript: ENSMUST00000090933
AA Change: Y1402H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: Y1402H

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186583
AA Change: Y1402H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: Y1402H

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88981712 missense probably benign 0.19
IGL00819:Ash1l APN 3 89007736 missense possibly damaging 0.68
IGL00939:Ash1l APN 3 89035236 missense probably damaging 0.99
IGL01064:Ash1l APN 3 89072484 missense probably damaging 1.00
IGL01066:Ash1l APN 3 88984635 missense probably damaging 1.00
IGL01087:Ash1l APN 3 89063902 missense probably damaging 1.00
IGL01293:Ash1l APN 3 88983529 missense probably benign 0.01
IGL01541:Ash1l APN 3 89066265 missense probably damaging 1.00
IGL01863:Ash1l APN 3 88985506 nonsense probably null
IGL02326:Ash1l APN 3 88966057 missense probably benign 0.00
IGL02407:Ash1l APN 3 89072548 missense probably damaging 1.00
IGL02419:Ash1l APN 3 88985565 missense probably benign 0.00
IGL02422:Ash1l APN 3 89069079 critical splice donor site probably null
IGL02494:Ash1l APN 3 89066218 nonsense probably null
IGL02727:Ash1l APN 3 89023037 missense probably benign
IGL02732:Ash1l APN 3 88966228 missense probably damaging 1.00
IGL02817:Ash1l APN 3 88984801 missense probably damaging 1.00
IGL02887:Ash1l APN 3 88984181 missense probably benign 0.11
IGL03224:Ash1l APN 3 89035268 splice site probably benign
IGL03253:Ash1l APN 3 88984674 missense probably damaging 1.00
IGL03327:Ash1l APN 3 89023083 missense probably benign 0.02
IGL03398:Ash1l APN 3 89007220 missense probably benign 0.01
3-1:Ash1l UTSW 3 88966326 missense probably benign
BB008:Ash1l UTSW 3 89043541 missense probably damaging 1.00
BB018:Ash1l UTSW 3 89043541 missense probably damaging 1.00
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0395:Ash1l UTSW 3 89058589 missense probably damaging 1.00
R0477:Ash1l UTSW 3 88983459 missense probably benign 0.41
R0528:Ash1l UTSW 3 88982277 missense probably benign
R0543:Ash1l UTSW 3 89063778 splice site probably null
R0855:Ash1l UTSW 3 89054454 missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1163:Ash1l UTSW 3 89035263 critical splice donor site probably null
R1196:Ash1l UTSW 3 88983316 missense probably damaging 0.99
R1419:Ash1l UTSW 3 88984897 missense probably damaging 0.99
R1445:Ash1l UTSW 3 89007352 missense probably benign 0.02
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1480:Ash1l UTSW 3 88985052 missense probably damaging 1.00
R1506:Ash1l UTSW 3 89058499 missense probably damaging 0.99
R1537:Ash1l UTSW 3 89072476 missense probably damaging 0.99
R1584:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1669:Ash1l UTSW 3 89067242 critical splice donor site probably null
R1713:Ash1l UTSW 3 89076224 missense probably damaging 1.00
R1780:Ash1l UTSW 3 88965984 missense probably benign
R1793:Ash1l UTSW 3 89070309 missense probably damaging 1.00
R1881:Ash1l UTSW 3 88981555 missense probably benign 0.00
R1909:Ash1l UTSW 3 88984528 missense probably benign 0.29
R1938:Ash1l UTSW 3 88984422 missense probably damaging 0.98
R2035:Ash1l UTSW 3 89066317 missense probably benign 0.00
R2070:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2071:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2114:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2116:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2118:Ash1l UTSW 3 88985295 missense possibly damaging 0.80
R2143:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2164:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2210:Ash1l UTSW 3 89066298 missense probably damaging 1.00
R2247:Ash1l UTSW 3 89007367 missense possibly damaging 0.77
R2303:Ash1l UTSW 3 89026426 missense probably damaging 1.00
R2860:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R2861:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R3104:Ash1l UTSW 3 89054386 missense probably damaging 1.00
R4133:Ash1l UTSW 3 88982260 missense probably benign 0.00
R4164:Ash1l UTSW 3 88981966 missense probably damaging 0.97
R4270:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4271:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4287:Ash1l UTSW 3 89066415 missense probably damaging 0.99
R4409:Ash1l UTSW 3 89007199 missense probably damaging 0.99
R4459:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R4487:Ash1l UTSW 3 88985315 missense possibly damaging 0.65
R4674:Ash1l UTSW 3 89072476 missense possibly damaging 0.80
R4739:Ash1l UTSW 3 88982845 missense probably benign 0.19
R4927:Ash1l UTSW 3 88985334 missense probably damaging 1.00
R5000:Ash1l UTSW 3 89058634 missense probably damaging 1.00
R5016:Ash1l UTSW 3 88982323 missense probably damaging 1.00
R5055:Ash1l UTSW 3 89023212 critical splice donor site probably null
R5081:Ash1l UTSW 3 88984717 missense probably damaging 1.00
R5082:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R5090:Ash1l UTSW 3 89052877 missense probably damaging 1.00
R5113:Ash1l UTSW 3 89066275 missense probably damaging 0.99
R5408:Ash1l UTSW 3 88982394 missense probably damaging 1.00
R5452:Ash1l UTSW 3 88984876 missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88981426 missense probably benign 0.17
R5610:Ash1l UTSW 3 89023185 missense probably damaging 1.00
R5624:Ash1l UTSW 3 88985609 missense probably damaging 1.00
R5682:Ash1l UTSW 3 89007607 missense probably damaging 0.99
R5712:Ash1l UTSW 3 89051990 missense probably damaging 0.99
R5719:Ash1l UTSW 3 89054498 missense possibly damaging 0.83
R5719:Ash1l UTSW 3 89058626 missense probably damaging 1.00
R5839:Ash1l UTSW 3 88983351 missense probably damaging 0.99
R5859:Ash1l UTSW 3 89068993 missense probably damaging 1.00
R5877:Ash1l UTSW 3 88981584 missense probably benign 0.00
R5940:Ash1l UTSW 3 88984036 missense probably damaging 0.96
R6026:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6029:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6089:Ash1l UTSW 3 89053143 nonsense probably null
R6110:Ash1l UTSW 3 88985129 missense probably damaging 1.00
R6168:Ash1l UTSW 3 89052773 nonsense probably null
R6200:Ash1l UTSW 3 89070527 missense probably damaging 1.00
R6290:Ash1l UTSW 3 88982761 nonsense probably null
R6331:Ash1l UTSW 3 89007865 missense probably benign 0.00
R6425:Ash1l UTSW 3 88983780 missense probably damaging 0.99
R6540:Ash1l UTSW 3 88985061 missense probably damaging 1.00
R6568:Ash1l UTSW 3 89052037 missense probably benign 0.09
R6828:Ash1l UTSW 3 89076113 missense probably benign 0.00
R6843:Ash1l UTSW 3 88985388 missense probably damaging 1.00
R6894:Ash1l UTSW 3 88982991 missense probably benign 0.00
R6976:Ash1l UTSW 3 88981657 missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88982671 missense probably benign 0.00
R7073:Ash1l UTSW 3 88985340 missense probably damaging 1.00
R7133:Ash1l UTSW 3 88983457 frame shift probably null
R7150:Ash1l UTSW 3 89077074 missense probably damaging 1.00
R7205:Ash1l UTSW 3 88965952 missense probably benign 0.00
R7254:Ash1l UTSW 3 89070509 missense probably damaging 1.00
R7272:Ash1l UTSW 3 89054634 splice site probably null
R7288:Ash1l UTSW 3 88965892 start gained probably benign
R7319:Ash1l UTSW 3 88981387 missense probably benign 0.19
R7341:Ash1l UTSW 3 88981759 missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88965997 missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88983865 missense probably benign 0.16
R7677:Ash1l UTSW 3 89043193 missense probably damaging 1.00
R7822:Ash1l UTSW 3 89007264 missense probably benign
R7857:Ash1l UTSW 3 88984309 nonsense probably null
R7889:Ash1l UTSW 3 88966038 missense probably benign 0.00
R7898:Ash1l UTSW 3 88983625 missense possibly damaging 0.54
R7931:Ash1l UTSW 3 89043541 missense probably damaging 1.00
R7937:Ash1l UTSW 3 89070317 nonsense probably null
R7973:Ash1l UTSW 3 89052857 missense probably benign
R8119:Ash1l UTSW 3 89035427 missense probably damaging 1.00
R8157:Ash1l UTSW 3 89063707 critical splice donor site probably null
R8162:Ash1l UTSW 3 89070246 missense probably damaging 0.99
R8194:Ash1l UTSW 3 89052755 missense probably damaging 1.00
R8306:Ash1l UTSW 3 88965952 missense probably benign 0.00
X0017:Ash1l UTSW 3 88984585 missense probably benign 0.45
X0019:Ash1l UTSW 3 89070556 missense probably damaging 1.00
X0021:Ash1l UTSW 3 88983204 missense probably benign 0.10
Z1088:Ash1l UTSW 3 88982709 missense probably benign 0.00
Z1176:Ash1l UTSW 3 89043217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTACATTCGGAAACCTG -3'
(R):5'- TAAGCCATCTCTGGAGGTACG -3'

Sequencing Primer
(F):5'- CAATGGCAGAAATGCCT -3'
(R):5'- CATCTCTGGAGGTACGCTGGG -3'
Posted On2017-06-26