Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Ndst4'

480097

Institutional Source

Beutler Lab

Gene Symbol

Ndst4

Ensembl Gene

ENSMUSG00000027971

Gene Name

N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4

Synonyms

MMRRC Submission

044199-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125404076-125728899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 125713376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 730 (A730S)

Ref Sequence

ENSEMBL: ENSMUSP00000133341 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173932] [ENSMUST00000174648] [ENSMUST00000198101]

AlphaFold

Q9EQW8

Predicted Effect

probably benign
Transcript: ENSMUST00000173932
AA Change: A730S

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: A730S

Domain	Start	End	E-Value	Type
Pfam:HSNSD	20	505	1.2e-251	PFAM
Pfam:Sulfotransfer_1	594	857	1.2e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174648
AA Change: A222S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000133575
Gene: ENSMUSG00000027971
AA Change: A222S

Domain	Start	End	E-Value	Type
Pfam:Sulfotransfer_1	86	349	6.6e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198101
AA Change: A71S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000142414
Gene: ENSMUSG00000027971
AA Change: A71S

Domain	Start	End	E-Value	Type
Pfam:Sulfotransfer_1	3	148	7e-22	PFAM

Meta Mutation Damage Score

0.1585

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Ndst4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00920:Ndst4	APN	3	125438211	missense	probably damaging	0.98
IGL00926:Ndst4	APN	3	125561453	missense	probably benign	0.01
IGL01292:Ndst4	APN	3	125438754	missense	probably damaging	1.00
IGL01797:Ndst4	APN	3	125683153	missense	probably damaging	0.99
R0004:Ndst4	UTSW	3	125570826	missense	probably benign	0.03
R0118:Ndst4	UTSW	3	125611561	nonsense	probably null
R0652:Ndst4	UTSW	3	125611539	missense	possibly damaging	0.93
R1437:Ndst4	UTSW	3	125561450	missense	probably damaging	0.97
R1502:Ndst4	UTSW	3	125437758	start gained	probably benign
R1900:Ndst4	UTSW	3	125697895	splice site	probably null
R1960:Ndst4	UTSW	3	125438682	nonsense	probably null
R2249:Ndst4	UTSW	3	125438174	missense	probably benign	0.16
R2334:Ndst4	UTSW	3	125708176	missense	possibly damaging	0.86
R2345:Ndst4	UTSW	3	125708120	missense	possibly damaging	0.95
R3617:Ndst4	UTSW	3	125438133	missense	probably benign	0.00
R3713:Ndst4	UTSW	3	125561505	missense	possibly damaging	0.93
R3715:Ndst4	UTSW	3	125561505	missense	possibly damaging	0.93
R3954:Ndst4	UTSW	3	125437905	missense	probably benign	0.01
R4013:Ndst4	UTSW	3	125683170	missense	probably damaging	1.00
R4035:Ndst4	UTSW	3	125438736	missense	probably damaging	1.00
R4085:Ndst4	UTSW	3	125609482	missense	probably benign
R4496:Ndst4	UTSW	3	125683273	missense	probably damaging	1.00
R4498:Ndst4	UTSW	3	125438358	missense	probably damaging	1.00
R5187:Ndst4	UTSW	3	125437911	missense	probably damaging	0.98
R5233:Ndst4	UTSW	3	125710117	missense	probably damaging	1.00
R5518:Ndst4	UTSW	3	125438456	missense	probably benign
R5575:Ndst4	UTSW	3	125437830	missense	probably benign	0.41
R5687:Ndst4	UTSW	3	125438609	missense	possibly damaging	0.79
R5940:Ndst4	UTSW	3	125561419	splice site	probably benign
R6406:Ndst4	UTSW	3	125438501	missense	probably benign
R6540:Ndst4	UTSW	3	125722152	nonsense	probably null
R6941:Ndst4	UTSW	3	125609511	missense	possibly damaging	0.93
R7108:Ndst4	UTSW	3	125561471	missense	probably damaging	0.96
R7269:Ndst4	UTSW	3	125438358	missense	probably damaging	1.00
R7278:Ndst4	UTSW	3	125438303	missense	probably benign	0.00
R7345:Ndst4	UTSW	3	125714659	missense	probably benign	0.07
R7405:Ndst4	UTSW	3	125683216	missense	probably benign
R7418:Ndst4	UTSW	3	125708151	missense	probably damaging	0.99
R7592:Ndst4	UTSW	3	125570787	missense	probably damaging	0.99
R7714:Ndst4	UTSW	3	125570844	missense	probably benign	0.08
R7955:Ndst4	UTSW	3	125438182	nonsense	probably null
R8070:Ndst4	UTSW	3	125714644	missense	probably damaging	1.00
R8412:Ndst4	UTSW	3	125570790	missense	possibly damaging	0.76
R8553:Ndst4	UTSW	3	125710107	missense	probably damaging	1.00
R8744:Ndst4	UTSW	3	125713340	missense	possibly damaging	0.94
R8933:Ndst4	UTSW	3	125611506	missense	probably damaging	0.99
R8940:Ndst4	UTSW	3	125681153	start gained	probably benign
R8984:Ndst4	UTSW	3	125722161	missense	probably damaging	1.00
R9147:Ndst4	UTSW	3	125438073	missense	probably damaging	1.00
R9148:Ndst4	UTSW	3	125438073	missense	probably damaging	1.00
R9194:Ndst4	UTSW	3	125724736	missense	probably benign	0.19
R9196:Ndst4	UTSW	3	125724736	missense	probably benign	0.19
R9202:Ndst4	UTSW	3	125724736	missense	probably benign	0.19
R9203:Ndst4	UTSW	3	125724736	missense	probably benign	0.19
R9217:Ndst4	UTSW	3	125724736	missense	probably benign	0.19
R9311:Ndst4	UTSW	3	125724736	missense	probably benign	0.19
R9355:Ndst4	UTSW	3	125609597	missense	probably damaging	1.00
X0027:Ndst4	UTSW	3	125437946	missense	probably benign
Z1177:Ndst4	UTSW	3	125570740	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTCAGACCCTTGTAGACAATCC -3'
(R):5'- GAGCCCTTTGACTCTATTCTATGG -3'

Sequencing Primer
(F):5'- AGACCCTTGTAGACAATCCTTTCATG -3'
(R):5'- GCTATTACCTGGGAAGTAGA -3'

Posted On

2017-06-26