Mutagenetix > Incidental Mutation

Incidental Mutation 'R6027:Ank2'

480098

Institutional Source

Beutler Lab

Gene Symbol

Ank2

Ensembl Gene

ENSMUSG00000032826

Gene Name

ankyrin 2, brain

Synonyms

Ankyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B

MMRRC Submission

044199-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126921612-127499350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126997879 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 763 (T763A)

Ref Sequence

ENSEMBL: ENSMUSP00000138753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044443] [ENSMUST00000182064] [ENSMUST00000182078] [ENSMUST00000182711] [ENSMUST00000182959]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044443

SMART Domains

Protein: ENSMUSP00000043765
Gene: ENSMUSG00000032826

Domain	Start	End	E-Value	Type
low complexity region	9	22	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
ZU5	128	232	4.13e-61	SMART
Pfam:ZU5	289	374	2.8e-8	PFAM
low complexity region	587	597	N/A	INTRINSIC
DEATH	603	697	1.52e-27	SMART
low complexity region	732	748	N/A	INTRINSIC
low complexity region	860	873	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182064
AA Change: T817A

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: T817A

Domain	Start	End	E-Value	Type
ANK	9	38	1e1	SMART
ANK	42	71	8.9e-7	SMART
ANK	75	104	4.4e-9	SMART
ANK	108	137	2.8e-9	SMART
ANK	141	169	5.3e-1	SMART
ANK	170	199	7.3e-1	SMART
ANK	211	240	1.1e-7	SMART
ANK	244	273	4.4e-9	SMART
ANK	277	306	9.3e-8	SMART
ANK	310	339	2.1e-8	SMART
ANK	343	372	1.3e-7	SMART
ANK	376	405	6.2e-9	SMART
ANK	409	438	1.1e-7	SMART
ANK	442	471	2.9e-8	SMART
ANK	475	504	1.1e-5	SMART
ANK	508	537	6.5e-6	SMART
ANK	541	570	2.3e-7	SMART
ANK	574	603	2.4e-7	SMART
ANK	607	636	3.2e-9	SMART
ANK	640	669	5.5e-5	SMART
ANK	673	702	1.9e-8	SMART
ANK	706	735	3.3e-9	SMART
low complexity region	755	775	N/A	INTRINSIC
low complexity region	793	806	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
ZU5	912	1016	2e-63	SMART
low complexity region	1371	1381	N/A	INTRINSIC
low complexity region	1448	1463	N/A	INTRINSIC
low complexity region	1490	1503	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182078
AA Change: T763A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: T763A

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
low complexity region	114	125	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	304	312	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
low complexity region	527	544	N/A	INTRINSIC
DEATH	591	685	1e-29	SMART
low complexity region	720	736	N/A	INTRINSIC
low complexity region	848	861	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182711
AA Change: T813A

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826
AA Change: T813A

Domain	Start	End	E-Value	Type
ANK	26	55	1e1	SMART
ANK	59	88	8.9e-7	SMART
ANK	92	121	4.4e-9	SMART
ANK	125	154	2.8e-9	SMART
ANK	158	186	5.3e-1	SMART
ANK	187	216	7.3e-1	SMART
ANK	228	257	1.1e-7	SMART
ANK	261	290	4.4e-9	SMART
ANK	294	323	9.3e-8	SMART
ANK	327	356	2.1e-8	SMART
ANK	360	389	1.3e-7	SMART
ANK	393	422	6.2e-9	SMART
ANK	426	455	1.1e-7	SMART
ANK	459	488	2.9e-8	SMART
ANK	492	521	1.1e-5	SMART
ANK	525	554	6.5e-6	SMART
ANK	558	587	2.3e-7	SMART
ANK	591	620	5.3e-7	SMART
ANK	624	653	2.4e-7	SMART
ANK	657	686	3.2e-9	SMART
ANK	690	719	5.5e-5	SMART
ANK	723	752	1.9e-8	SMART
ANK	756	785	3.3e-9	SMART
low complexity region	805	825	N/A	INTRINSIC
low complexity region	843	856	N/A	INTRINSIC
ZU5	961	1098	1.1e-50	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182959
AA Change: T796A

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138251
Gene: ENSMUSG00000032826
AA Change: T796A

Domain	Start	End	E-Value	Type
ANK	9	38	1.63e3	SMART
ANK	42	71	1.4e-4	SMART
ANK	75	104	6.76e-7	SMART
ANK	108	137	4.46e-7	SMART
ANK	141	169	8.36e1	SMART
ANK	170	199	1.17e2	SMART
ANK	211	240	1.76e-5	SMART
ANK	244	273	6.76e-7	SMART
ANK	277	306	1.43e-5	SMART
ANK	310	339	3.33e-6	SMART
ANK	343	372	2.02e-5	SMART
ANK	376	405	9.55e-7	SMART
ANK	409	438	1.76e-5	SMART
ANK	442	471	4.71e-6	SMART
ANK	475	504	1.7e-3	SMART
ANK	508	537	1.05e-3	SMART
ANK	541	570	3.51e-5	SMART
ANK	574	603	8.65e-5	SMART
ANK	607	636	3.76e-5	SMART
ANK	640	669	5.12e-7	SMART
ANK	673	702	8.39e-3	SMART
ANK	706	735	2.9e-6	SMART
ANK	739	768	5.12e-7	SMART
low complexity region	788	808	N/A	INTRINSIC
low complexity region	826	839	N/A	INTRINSIC
low complexity region	874	886	N/A	INTRINSIC
Pfam:ZU5	945	1028	1.5e-30	PFAM
Pfam:ZU5	1021	1082	4.4e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183075

Meta Mutation Damage Score

0.7086

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Ank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01298:Ank2	APN	3	126959720	missense	possibly damaging	0.80
IGL01652:Ank2	APN	3	126933041	missense	probably benign	0.00
IGL01969:Ank2	APN	3	126953223	missense	possibly damaging	0.47
IGL02122:Ank2	APN	3	126937874	splice site	probably benign
IGL02537:Ank2	APN	3	126955916	missense	probably damaging	1.00
IGL02858:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL02981:Ank2	APN	3	126934562	missense	possibly damaging	0.58
IGL02981:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03024:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03074:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03111:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03129:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03174:Ank2	APN	3	126940095	missense	probably damaging	0.98
IGL03177:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03185:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03188:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03242:Ank2	APN	3	126928805	missense	possibly damaging	0.90
IGL03244:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03248:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03285:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03304:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03358:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03380:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03389:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03400:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03409:Ank2	APN	3	126955870	missense	probably damaging	1.00
ballast	UTSW	3	126943133	missense	unknown
Chain	UTSW	3	126946938	intron	probably benign
Deadman	UTSW	3	126929822	missense	probably benign	0.19
drag	UTSW	3	127003982	missense	probably damaging	1.00
mooring	UTSW	3	126934577	missense	possibly damaging	0.73
Treasure	UTSW	3	126946749	missense	unknown
Windlass	UTSW	3	126946149	missense	probably benign
R0033:Ank2	UTSW	3	127104748	splice site	probably benign
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0079:Ank2	UTSW	3	126934615	missense	probably benign	0.01
R0423:Ank2	UTSW	3	126929860	nonsense	probably null
R0699:Ank2	UTSW	3	126929829	missense	probably benign	0.00
R0724:Ank2	UTSW	3	126962337	missense	probably damaging	1.00
R0990:Ank2	UTSW	3	126934666	missense	possibly damaging	0.64
R1450:Ank2	UTSW	3	126957302	missense	possibly damaging	0.94
R1500:Ank2	UTSW	3	126932982	missense	probably benign
R1702:Ank2	UTSW	3	126955899	missense	probably benign	0.00
R1703:Ank2	UTSW	3	126929766	missense	probably damaging	1.00
R1710:Ank2	UTSW	3	126933060	nonsense	probably null
R1743:Ank2	UTSW	3	126928675	missense	probably damaging	0.99
R1775:Ank2	UTSW	3	126934547	missense	probably benign	0.00
R1852:Ank2	UTSW	3	126997851	critical splice donor site	probably null
R2198:Ank2	UTSW	3	126934577	missense	possibly damaging	0.73
R2892:Ank2	UTSW	3	127248243	splice site	probably null
R2893:Ank2	UTSW	3	127248243	splice site	probably null
R2894:Ank2	UTSW	3	127248243	splice site	probably null
R3148:Ank2	UTSW	3	126933075	missense	probably benign	0.00
R3776:Ank2	UTSW	3	126942262	intron	probably benign
R3784:Ank2	UTSW	3	126953193	missense	probably damaging	1.00
R3856:Ank2	UTSW	3	126929844	missense	probably benign	0.00
R3906:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3907:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3953:Ank2	UTSW	3	126988160	missense	probably damaging	1.00
R3963:Ank2	UTSW	3	126934596	missense	probably benign
R4367:Ank2	UTSW	3	126946149	missense	probably benign
R4414:Ank2	UTSW	3	127225762	critical splice donor site	probably null
R4432:Ank2	UTSW	3	126947806	intron	probably benign
R4433:Ank2	UTSW	3	126947806	intron	probably benign
R4579:Ank2	UTSW	3	126958963	missense	probably damaging	1.00
R4597:Ank2	UTSW	3	126988151	missense	probably damaging	1.00
R4603:Ank2	UTSW	3	127032016	missense	probably benign	0.00
R4729:Ank2	UTSW	3	126976896	nonsense	probably null
R4815:Ank2	UTSW	3	126936761	missense	probably benign
R4826:Ank2	UTSW	3	126956001	missense	probably benign	0.35
R4871:Ank2	UTSW	3	126959795	missense	probably damaging	1.00
R4880:Ank2	UTSW	3	127046826	splice site	probably null
R4915:Ank2	UTSW	3	126942671	intron	probably benign
R4935:Ank2	UTSW	3	126956064	missense	probably damaging	1.00
R4936:Ank2	UTSW	3	126955039	missense	possibly damaging	0.94
R4937:Ank2	UTSW	3	126962401	missense	probably damaging	1.00
R4946:Ank2	UTSW	3	126941940	intron	probably benign
R4963:Ank2	UTSW	3	127032096	missense	probably benign	0.01
R4989:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5023:Ank2	UTSW	3	126941871	intron	probably benign
R5060:Ank2	UTSW	3	126945921	intron	probably benign
R5078:Ank2	UTSW	3	126942353	intron	probably benign
R5086:Ank2	UTSW	3	126947348	intron	probably benign
R5134:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5148:Ank2	UTSW	3	127025636	splice site	probably null
R5175:Ank2	UTSW	3	127004024	missense	probably damaging	1.00
R5275:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5295:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5303:Ank2	UTSW	3	126945804	intron	probably benign
R5309:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5312:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5352:Ank2	UTSW	3	127498991	utr 5 prime	probably benign
R5355:Ank2	UTSW	3	126944049	intron	probably benign
R5386:Ank2	UTSW	3	126981933	missense	probably benign	0.01
R5396:Ank2	UTSW	3	126953226	missense	probably damaging	1.00
R5518:Ank2	UTSW	3	126959699	missense	probably damaging	0.98
R5534:Ank2	UTSW	3	126947298	intron	probably benign
R5554:Ank2	UTSW	3	126998973	missense	possibly damaging	0.78
R5582:Ank2	UTSW	3	126946305	intron	probably benign
R5747:Ank2	UTSW	3	126941751	intron	probably benign
R5794:Ank2	UTSW	3	126930020	missense	probably benign	0.00
R5831:Ank2	UTSW	3	127339159	start gained	probably benign
R5925:Ank2	UTSW	3	126932963	missense	probably benign	0.18
R5954:Ank2	UTSW	3	126997861	missense	probably benign	0.34
R5956:Ank2	UTSW	3	126942688	intron	probably benign
R5986:Ank2	UTSW	3	127012686	missense	possibly damaging	0.94
R5992:Ank2	UTSW	3	126959651	critical splice donor site	probably null
R6020:Ank2	UTSW	3	126946821	intron	probably benign
R6049:Ank2	UTSW	3	126943020	missense	possibly damaging	0.95
R6060:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
R6114:Ank2	UTSW	3	127011051	missense	probably damaging	1.00
R6124:Ank2	UTSW	3	127248151	missense	probably benign	0.31
R6156:Ank2	UTSW	3	126944237	missense	probably damaging	1.00
R6173:Ank2	UTSW	3	127052746	missense	probably damaging	1.00
R6176:Ank2	UTSW	3	126945471	missense	probably benign	0.05
R6184:Ank2	UTSW	3	126962398	missense	probably damaging	1.00
R6199:Ank2	UTSW	3	127004006	missense	probably damaging	1.00
R6241:Ank2	UTSW	3	127052748	missense	probably damaging	1.00
R6254:Ank2	UTSW	3	126941804	intron	probably benign
R6259:Ank2	UTSW	3	127016986	missense	probably benign	0.28
R6260:Ank2	UTSW	3	126943557	missense	probably benign
R6321:Ank2	UTSW	3	126946938	intron	probably benign
R6393:Ank2	UTSW	3	126929757	missense	probably damaging	1.00
R6406:Ank2	UTSW	3	127032225	missense	probably damaging	1.00
R6544:Ank2	UTSW	3	126933222	missense	probably damaging	0.99
R6583:Ank2	UTSW	3	127016964	missense	probably damaging	1.00
R6739:Ank2	UTSW	3	127079994	missense	probably damaging	1.00
R6754:Ank2	UTSW	3	127096839	intron	probably benign
R6786:Ank2	UTSW	3	126958932	missense	probably damaging	0.99
R6798:Ank2	UTSW	3	126944264	intron	probably benign
R6882:Ank2	UTSW	3	126945757	intron	probably benign
R6940:Ank2	UTSW	3	126941972	intron	probably benign
R6949:Ank2	UTSW	3	127010884	missense	probably benign	0.00
R7001:Ank2	UTSW	3	127077581	missense	probably damaging	1.00
R7033:Ank2	UTSW	3	126944850	nonsense	probably null
R7036:Ank2	UTSW	3	126946392	intron	probably benign
R7045:Ank2	UTSW	3	127012744	missense	probably damaging	1.00
R7048:Ank2	UTSW	3	127025618	missense	probably benign	0.03
R7054:Ank2	UTSW	3	126943303	intron	probably benign
R7069:Ank2	UTSW	3	126946298	intron	probably benign
R7091:Ank2	UTSW	3	127023351	missense	probably damaging	0.98
R7107:Ank2	UTSW	3	127003982	missense	probably damaging	1.00
R7175:Ank2	UTSW	3	126946941	missense	unknown
R7191:Ank2	UTSW	3	126946392	missense	unknown
R7272:Ank2	UTSW	3	126943133	missense	unknown
R7381:Ank2	UTSW	3	126936628	missense	possibly damaging	0.46
R7394:Ank2	UTSW	3	126936653	missense	possibly damaging	0.77
R7462:Ank2	UTSW	3	126943034	missense	unknown
R7490:Ank2	UTSW	3	126958889	missense	probably damaging	0.99
R7514:Ank2	UTSW	3	127025603	missense	probably benign	0.06
R7534:Ank2	UTSW	3	126934333	splice site	probably null
R7540:Ank2	UTSW	3	126988159	missense	possibly damaging	0.94
R7547:Ank2	UTSW	3	126945203	missense	unknown
R7579:Ank2	UTSW	3	126946398	missense	unknown
R7584:Ank2	UTSW	3	126946128	nonsense	probably null
R7625:Ank2	UTSW	3	127052800	missense	probably damaging	1.00
R7698:Ank2	UTSW	3	127032211	missense	probably benign	0.35
R7716:Ank2	UTSW	3	126943166	missense	unknown
R7718:Ank2	UTSW	3	126965013	missense	possibly damaging	0.88
R7722:Ank2	UTSW	3	127029302	missense	probably benign	0.01
R7738:Ank2	UTSW	3	126947622	missense
R7977:Ank2	UTSW	3	126945707	missense	unknown
R7987:Ank2	UTSW	3	126945707	missense	unknown
R8007:Ank2	UTSW	3	126936447	intron	probably benign
R8150:Ank2	UTSW	3	126947513	missense
R8161:Ank2	UTSW	3	127032129	missense
R8196:Ank2	UTSW	3	126929883	missense	probably damaging	0.99
R8248:Ank2	UTSW	3	126937785	missense	possibly damaging	0.78
R8255:Ank2	UTSW	3	126946749	missense	unknown
R8279:Ank2	UTSW	3	126933171	missense	probably benign	0.04
R8300:Ank2	UTSW	3	127010906	missense
R8716:Ank2	UTSW	3	126942839	nonsense	probably null
R8724:Ank2	UTSW	3	126943756	missense	unknown
R8765:Ank2	UTSW	3	127057082	missense	possibly damaging	0.94
R8779:Ank2	UTSW	3	126965102	missense	probably damaging	0.99
R8783:Ank2	UTSW	3	127052806	missense	probably damaging	1.00
R8785:Ank2	UTSW	3	126997921	missense	probably damaging	1.00
R8826:Ank2	UTSW	3	126947302	missense	unknown
R8872:Ank2	UTSW	3	126997876	missense	possibly damaging	0.88
R8903:Ank2	UTSW	3	127046782	missense	probably damaging	1.00
R8906:Ank2	UTSW	3	126933071	missense	probably benign	0.00
R8918:Ank2	UTSW	3	126943731	missense	unknown
R8947:Ank2	UTSW	3	126942747	intron	probably benign
R8977:Ank2	UTSW	3	126944926	missense	unknown
R8990:Ank2	UTSW	3	127048180	critical splice donor site	probably null
R8994:Ank2	UTSW	3	126929822	missense	probably benign	0.19
R9009:Ank2	UTSW	3	126934376	unclassified	probably benign
R9123:Ank2	UTSW	3	126940095	missense	probably damaging	1.00
R9125:Ank2	UTSW	3	126940095	missense	probably damaging	1.00
R9130:Ank2	UTSW	3	127016916	missense
R9175:Ank2	UTSW	3	126928753	missense	possibly damaging	0.52
R9220:Ank2	UTSW	3	126943437	missense	unknown
R9225:Ank2	UTSW	3	126942462	missense	unknown
R9286:Ank2	UTSW	3	127052732	missense	probably damaging	0.99
R9325:Ank2	UTSW	3	126981855	missense	probably damaging	0.98
R9367:Ank2	UTSW	3	126945029	missense	unknown
R9385:Ank2	UTSW	3	126959717	missense	probably benign	0.00
R9391:Ank2	UTSW	3	126937745	missense	probably damaging	0.99
R9422:Ank2	UTSW	3	127096856	missense	unknown
R9536:Ank2	UTSW	3	126942382	missense	unknown
R9647:Ank2	UTSW	3	126998974	missense	possibly damaging	0.93
R9650:Ank2	UTSW	3	126942180	missense	unknown
R9666:Ank2	UTSW	3	126933189	nonsense	probably null
R9686:Ank2	UTSW	3	126946901	missense	unknown
R9730:Ank2	UTSW	3	127225844	missense
R9738:Ank2	UTSW	3	126943472	missense	unknown
R9743:Ank2	UTSW	3	126940145	missense	possibly damaging	0.81
R9747:Ank2	UTSW	3	126959018	missense	probably damaging	1.00
R9800:Ank2	UTSW	3	126946500	missense	unknown
R9803:Ank2	UTSW	3	126959077	missense	possibly damaging	0.64
RF020:Ank2	UTSW	3	126945476	missense	unknown
Z1088:Ank2	UTSW	3	127029509	missense	possibly damaging	0.45
Z1177:Ank2	UTSW	3	126944357	missense	unknown
Z1187:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
Z1190:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
Z1192:Ank2	UTSW	3	126955952	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAACCCTCGTGTCCATTG -3'
(R):5'- AAACTAGTGATTTTCCTGAGCTGTG -3'

Sequencing Primer
(F):5'- CCTCGTGTCCATTGGTGAACG -3'
(R):5'- ATTTTCCTGAGCTGTGCCTTG -3'

Posted On

2017-06-26