Incidental Mutation 'R6027:Hmox1'
ID480106
Institutional Source Beutler Lab
Gene Symbol Hmox1
Ensembl Gene ENSMUSG00000005413
Gene Nameheme oxygenase 1
SynonymsHO1, HO-1, D8Wsu38e, heme oxygenase 1, Hmox, Hsp32
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location75093621-75100589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75096871 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 56 (H56N)
Ref Sequence ENSEMBL: ENSMUSP00000005548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005548]
Predicted Effect probably damaging
Transcript: ENSMUST00000005548
AA Change: H56N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005548
Gene: ENSMUSG00000005413
AA Change: H56N

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 11 216 7.3e-85 PFAM
transmembrane domain 266 288 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159631
SMART Domains Protein: ENSMUSP00000135466
Gene: ENSMUSG00000005413

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 3 158 4.2e-66 PFAM
Meta Mutation Damage Score 0.6264 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit low serum iron levels, increased hepatic and renal iron, oxidative damage, tissue injury, chronic inflammation, reduced neuronal proliferation, and increased sensitivity to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Hmox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0194:Hmox1 UTSW 8 75097108 missense probably damaging 1.00
R0866:Hmox1 UTSW 8 75097303 missense probably benign 0.03
R1469:Hmox1 UTSW 8 75098835 missense probably benign
R1469:Hmox1 UTSW 8 75098835 missense probably benign
R1559:Hmox1 UTSW 8 75099949 missense probably damaging 0.97
R7194:Hmox1 UTSW 8 75096923 missense probably benign 0.01
R7308:Hmox1 UTSW 8 75097019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGGGCTTAAATGCACAG -3'
(R):5'- GACGCTTTACATAGTGCTGTG -3'

Sequencing Primer
(F):5'- GCCGGGCTTAAATGCACAGTATATAC -3'
(R):5'- TACATAGTGCTGTGTGGCTGGC -3'
Posted On2017-06-26