Incidental Mutation 'R6027:Mmp15'
ID 480108
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Name matrix metallopeptidase 15
Synonyms MT2-MMP, Membrane type 2-MMP
MMRRC Submission 044199-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6027 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 96078924-96100921 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 96098804 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 544 (H544N)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
AlphaFold O54732
Predicted Effect probably benign
Transcript: ENSMUST00000034243
AA Change: H544N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: H544N

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212235
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,289,003 (GRCm39) V2299A probably benign Het
Acacb A G 5: 114,303,661 (GRCm39) D28G probably benign Het
Adamts6 G A 13: 104,616,043 (GRCm39) G1035D probably damaging Het
Adamts7 A C 9: 90,073,078 (GRCm39) Y755S probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ank2 T C 3: 126,791,528 (GRCm39) T763A possibly damaging Het
Armc9 G C 1: 86,172,389 (GRCm39) L105F probably damaging Het
Asah2 T C 19: 32,022,351 (GRCm39) N228D probably benign Het
Ash1l T C 3: 88,892,326 (GRCm39) Y1402H probably damaging Het
Aspm T G 1: 139,390,794 (GRCm39) V693G probably damaging Het
Bptf T C 11: 106,965,771 (GRCm39) E1141G probably damaging Het
Col12a1 C T 9: 79,563,860 (GRCm39) probably null Het
Csmd2 G A 4: 128,453,739 (GRCm39) D3475N unknown Het
Dctn5 T C 7: 121,732,564 (GRCm39) probably benign Het
Dhrs4 A G 14: 55,723,580 (GRCm39) K18E probably benign Het
Eci2 A T 13: 35,169,930 (GRCm39) probably null Het
Efcab6 A G 15: 83,851,922 (GRCm39) F319L probably benign Het
Elane A T 10: 79,722,852 (GRCm39) H86L probably damaging Het
Endod1 A T 9: 14,268,893 (GRCm39) Y197* probably null Het
Eno4 A G 19: 58,935,262 (GRCm39) D158G probably damaging Het
Fam217a T A 13: 35,094,977 (GRCm39) T170S possibly damaging Het
Fbxo7 A G 10: 85,883,950 (GRCm39) D517G probably damaging Het
Fkbp3 G T 12: 65,120,692 (GRCm39) A2E possibly damaging Het
Gan A G 8: 117,885,034 (GRCm39) Y54C probably damaging Het
Gdap1l1 T A 2: 163,293,531 (GRCm39) N194K possibly damaging Het
Gnptab A G 10: 88,269,087 (GRCm39) T597A probably damaging Het
Hmcn1 A G 1: 150,678,646 (GRCm39) S492P possibly damaging Het
Hmox1 C A 8: 75,823,499 (GRCm39) H56N probably damaging Het
Kank3 C T 17: 34,037,088 (GRCm39) P131S possibly damaging Het
Kif14 T C 1: 136,410,797 (GRCm39) probably null Het
Kif1a A T 1: 92,953,365 (GRCm39) M1274K probably benign Het
Kmt2a A T 9: 44,730,587 (GRCm39) probably benign Het
Lypla1 T C 1: 4,907,299 (GRCm39) probably null Het
Man2b1 C T 8: 85,823,381 (GRCm39) T905I probably damaging Het
Myh7 A T 14: 55,208,259 (GRCm39) N1933K probably benign Het
Ndst4 G T 3: 125,507,025 (GRCm39) A730S probably benign Het
Nmur1 G A 1: 86,315,053 (GRCm39) Q238* probably null Het
Nwd2 C T 5: 63,965,563 (GRCm39) P1716S possibly damaging Het
Or13c7c A G 4: 43,835,842 (GRCm39) V216A probably benign Het
Or8b36 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 37,937,836 (GRCm39) probably null Het
Or8k38 T G 2: 86,488,148 (GRCm39) Y218S probably damaging Het
P2ry6 T G 7: 100,587,715 (GRCm39) M215L probably benign Het
Parp4 G A 14: 56,866,615 (GRCm39) E1060K probably benign Het
Pde10a A G 17: 9,183,509 (GRCm39) I822V possibly damaging Het
Pira13 T C 7: 3,827,638 (GRCm39) Y173C possibly damaging Het
Pkd1l1 C A 11: 8,866,272 (GRCm39) G528* probably null Het
Ptk2 T A 15: 73,101,762 (GRCm39) Q816L probably damaging Het
Ptprg T C 14: 12,220,613 (GRCm38) F442L possibly damaging Het
Qrfpr A G 3: 36,276,187 (GRCm39) Y68H probably benign Het
Ripk4 A G 16: 97,545,274 (GRCm39) W458R probably damaging Het
Ros1 G T 10: 52,040,064 (GRCm39) T309N possibly damaging Het
Rps27a T C 11: 29,497,808 (GRCm39) probably benign Het
Sarm1 T A 11: 78,374,384 (GRCm39) M577L probably benign Het
Scin T C 12: 40,127,515 (GRCm39) Y425C probably damaging Het
Serpina12 T A 12: 103,997,336 (GRCm39) Y395F probably benign Het
Sfxn2 T A 19: 46,571,291 (GRCm39) Y69* probably null Het
Skint6 T C 4: 112,953,761 (GRCm39) probably null Het
Slc7a1 A C 5: 148,270,774 (GRCm39) I564S possibly damaging Het
Smc6 T A 12: 11,356,179 (GRCm39) Y933N probably benign Het
Sp110 T C 1: 85,505,039 (GRCm39) S438G possibly damaging Het
St8sia4 T A 1: 95,581,399 (GRCm39) R114S probably damaging Het
Trim11 C T 11: 58,869,289 (GRCm39) A75V possibly damaging Het
Tufm T A 7: 126,086,920 (GRCm39) H68Q probably damaging Het
Ythdc2 T A 18: 44,993,503 (GRCm39) D194E probably benign Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 96,092,959 (GRCm39) missense probably benign 0.31
IGL03001:Mmp15 APN 8 96,094,845 (GRCm39) missense probably damaging 0.97
R0147:Mmp15 UTSW 8 96,098,945 (GRCm39) missense probably benign 0.18
R0148:Mmp15 UTSW 8 96,098,945 (GRCm39) missense probably benign 0.18
R0437:Mmp15 UTSW 8 96,097,400 (GRCm39) missense probably benign 0.04
R0465:Mmp15 UTSW 8 96,094,626 (GRCm39) missense probably damaging 1.00
R0548:Mmp15 UTSW 8 96,098,979 (GRCm39) missense probably damaging 1.00
R0574:Mmp15 UTSW 8 96,092,029 (GRCm39) missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 96,098,762 (GRCm39) missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 96,094,856 (GRCm39) missense probably benign 0.01
R1341:Mmp15 UTSW 8 96,098,931 (GRCm39) missense probably benign 0.03
R1428:Mmp15 UTSW 8 96,096,190 (GRCm39) missense probably benign 0.34
R1840:Mmp15 UTSW 8 96,092,048 (GRCm39) missense probably damaging 1.00
R2061:Mmp15 UTSW 8 96,097,407 (GRCm39) missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 96,096,801 (GRCm39) missense probably benign 0.38
R4760:Mmp15 UTSW 8 96,094,824 (GRCm39) missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 96,098,958 (GRCm39) missense probably benign 0.00
R5233:Mmp15 UTSW 8 96,097,696 (GRCm39) missense probably benign 0.08
R5394:Mmp15 UTSW 8 96,093,032 (GRCm39) missense probably damaging 0.96
R5502:Mmp15 UTSW 8 96,094,812 (GRCm39) missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 96,094,729 (GRCm39) missense possibly damaging 0.85
R6341:Mmp15 UTSW 8 96,092,091 (GRCm39) critical splice donor site probably null
R6720:Mmp15 UTSW 8 96,091,942 (GRCm39) missense probably benign 0.22
R7788:Mmp15 UTSW 8 96,094,776 (GRCm39) missense probably damaging 1.00
R8033:Mmp15 UTSW 8 96,094,590 (GRCm39) missense probably benign 0.01
R8679:Mmp15 UTSW 8 96,092,982 (GRCm39) missense possibly damaging 0.83
R8791:Mmp15 UTSW 8 96,096,288 (GRCm39) nonsense probably null
R9028:Mmp15 UTSW 8 96,096,316 (GRCm39) missense probably benign 0.01
R9227:Mmp15 UTSW 8 96,092,959 (GRCm39) missense probably benign 0.06
R9230:Mmp15 UTSW 8 96,092,959 (GRCm39) missense probably benign 0.06
R9350:Mmp15 UTSW 8 96,093,002 (GRCm39) missense probably damaging 0.97
R9632:Mmp15 UTSW 8 96,098,731 (GRCm39) critical splice acceptor site probably null
R9695:Mmp15 UTSW 8 96,097,414 (GRCm39) missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CGGAAGATCCAGGACCATTTAACG -3'
(R):5'- ATCACCACGTTCACTGTCCG -3'

Sequencing Primer
(F):5'- GATCCAGGACCATTTAACGTGTTC -3'
(R):5'- ACGTTCACTGTCCGGACCAC -3'
Posted On 2017-06-26