Mutagenetix > Incidental Mutations

Incidental Mutation 'R6027:Adamts7'

480114

Institutional Source

Beutler Lab

Gene Symbol

Adamts7

Ensembl Gene

ENSMUSG00000032363

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7

Synonyms

ADAM-TS7

MMRRC Submission

044199-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R6027 (G1)

Quality Score

195.009

Status

Validated

Chromosome

Chromosomal Location

90163069-90208071 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 90191025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 755 (Y755S)

Ref Sequence

ENSEMBL: ENSMUSP00000129292 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]

AlphaFold

Q68SA9

Predicted Effect

probably damaging
Transcript: ENSMUST00000113059
AA Change: Y755S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: Y755S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	174	1.1e-36	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.3e-16	PFAM
Pfam:Reprolysin_4	224	425	8.5e-9	PFAM
Pfam:Reprolysin	226	437	2.2e-27	PFAM
Pfam:Reprolysin_2	244	427	2.9e-12	PFAM
Pfam:Reprolysin_3	248	383	5.2e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	2.2e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113060
AA Change: Y755S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: Y755S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	3.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.6e-16	PFAM
Pfam:Reprolysin_4	224	425	8.2e-9	PFAM
Pfam:Reprolysin	226	437	6.4e-30	PFAM
Pfam:Reprolysin_2	244	427	4.6e-12	PFAM
Pfam:Reprolysin_3	248	383	8.1e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.5e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1343	1393	2.4e-2	SMART
TSP1	1394	1451	1.8e-2	SMART
TSP1	1453	1500	4.82e-2	SMART
TSP1	1501	1558	1.39e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124441

Predicted Effect

probably benign
Transcript: ENSMUST00000134996

SMART Domains

Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.4e-29	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	412	1e-17	PFAM
Pfam:Reprolysin_4	224	426	5e-10	PFAM
Pfam:Reprolysin	226	437	3.7e-31	PFAM
Pfam:Reprolysin_2	244	427	3.2e-13	PFAM
Pfam:Reprolysin_3	248	383	6.3e-14	PFAM
Blast:ACR	439	505	7e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144943

Predicted Effect

probably damaging
Transcript: ENSMUST00000147250
AA Change: Y755S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: Y755S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	2.7e-26	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	1.4e-14	PFAM
Pfam:Reprolysin_4	224	425	7e-7	PFAM
Pfam:Reprolysin	226	437	4.9e-28	PFAM
Pfam:Reprolysin_2	244	427	5e-10	PFAM
Pfam:Reprolysin_3	248	383	6.5e-11	PFAM
ACR	439	515	1.7e-5	SMART
TSP1	526	578	2.3e-15	SMART
Pfam:ADAM_spacer1	683	794	3.5e-34	PFAM
TSP1	807	863	6.9e-9	SMART
TSP1	866	908	1.2e-3	SMART
low complexity region	969	983	N/A	INTRINSIC
low complexity region	1169	1191	N/A	INTRINSIC
TSP1	1284	1334	1.2e-4	SMART
TSP1	1335	1392	8.7e-5	SMART
TSP1	1394	1441	2.3e-4	SMART
TSP1	1442	1499	6.5e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167122
AA Change: Y755S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: Y755S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Pep_M12B_propep	33	174	1.4e-28	PFAM
low complexity region	203	220	N/A	INTRINSIC
Pfam:Reprolysin_5	224	411	7.2e-17	PFAM
Pfam:Reprolysin_4	224	425	3.6e-9	PFAM
Pfam:Reprolysin	226	437	2.9e-30	PFAM
Pfam:Reprolysin_2	244	427	2.2e-12	PFAM
Pfam:Reprolysin_3	248	383	3.7e-13	PFAM
Blast:ACR	442	513	5e-15	BLAST
TSP1	526	578	4.9e-13	SMART
Pfam:ADAM_spacer1	683	794	1.1e-36	PFAM
TSP1	807	863	1.45e-6	SMART
TSP1	866	908	2.41e-1	SMART
TSP1	929	978	1.45e-6	SMART
low complexity region	1011	1025	N/A	INTRINSIC
low complexity region	1211	1233	N/A	INTRINSIC
TSP1	1385	1435	2.4e-2	SMART
TSP1	1436	1493	1.8e-2	SMART
TSP1	1495	1542	4.82e-2	SMART
TSP1	1543	1600	1.39e-3	SMART

Meta Mutation Damage Score

0.8381

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptk2	T	A	15: 73,229,913	Q816L	probably damaging	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Adamts7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Adamts7	APN	9	90194249	missense	possibly damaging	0.71
IGL00673:Adamts7	APN	9	90193661	missense	possibly damaging	0.78
IGL00902:Adamts7	APN	9	90188794	critical splice donor site	probably null
IGL01303:Adamts7	APN	9	90171734	missense	possibly damaging	0.46
IGL01333:Adamts7	APN	9	90186979	missense	probably damaging	1.00
IGL01431:Adamts7	APN	9	90207785	missense	possibly damaging	0.89
IGL01595:Adamts7	APN	9	90193306	missense	probably benign	0.02
IGL02728:Adamts7	APN	9	90191827	splice site	probably benign
IGL02860:Adamts7	APN	9	90191862	missense	probably benign
IGL03237:Adamts7	APN	9	90188664	missense	probably damaging	1.00
PIT4495001:Adamts7	UTSW	9	90174622	missense	probably damaging	1.00
R0044:Adamts7	UTSW	9	90171588	missense	possibly damaging	0.58
R0078:Adamts7	UTSW	9	90179411	missense	probably damaging	1.00
R0107:Adamts7	UTSW	9	90180720	missense	possibly damaging	0.82
R0122:Adamts7	UTSW	9	90179421	missense	probably damaging	1.00
R0166:Adamts7	UTSW	9	90193692	missense	probably benign	0.00
R0517:Adamts7	UTSW	9	90199858	missense	probably benign	0.01
R1442:Adamts7	UTSW	9	90188770	missense	probably damaging	0.99
R1468:Adamts7	UTSW	9	90188798	splice site	probably benign
R1554:Adamts7	UTSW	9	90173650	missense	probably damaging	1.00
R1612:Adamts7	UTSW	9	90188697	missense	possibly damaging	0.86
R1652:Adamts7	UTSW	9	90189644	missense	probably damaging	1.00
R2007:Adamts7	UTSW	9	90177856	missense	probably damaging	1.00
R2091:Adamts7	UTSW	9	90188440	critical splice donor site	probably null
R2202:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2204:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2205:Adamts7	UTSW	9	90180676	missense	probably damaging	1.00
R2305:Adamts7	UTSW	9	90180711	missense	probably benign	0.39
R2409:Adamts7	UTSW	9	90180687	missense	probably damaging	1.00
R4157:Adamts7	UTSW	9	90188361	missense	probably damaging	1.00
R4210:Adamts7	UTSW	9	90194010	missense	possibly damaging	0.95
R4368:Adamts7	UTSW	9	90195851	critical splice donor site	probably null
R4533:Adamts7	UTSW	9	90180708	missense	probably damaging	1.00
R4608:Adamts7	UTSW	9	90174540	missense	probably damaging	1.00
R4623:Adamts7	UTSW	9	90186462	missense	probably benign	0.17
R4661:Adamts7	UTSW	9	90193330	missense	probably benign	0.02
R4820:Adamts7	UTSW	9	90189686	missense	possibly damaging	0.62
R4942:Adamts7	UTSW	9	90163311	missense	probably benign
R4961:Adamts7	UTSW	9	90185740	missense	probably damaging	1.00
R5064:Adamts7	UTSW	9	90195830	missense	probably damaging	1.00
R5763:Adamts7	UTSW	9	90188409	missense	probably damaging	1.00
R5921:Adamts7	UTSW	9	90188694	missense	probably benign	0.20
R6182:Adamts7	UTSW	9	90192436	missense	probably benign	0.01
R6306:Adamts7	UTSW	9	90178278	critical splice donor site	probably null
R6404:Adamts7	UTSW	9	90180456	splice site	probably null
R6488:Adamts7	UTSW	9	90171482	missense	probably benign	0.00
R6649:Adamts7	UTSW	9	90191937	missense	probably damaging	1.00
R6658:Adamts7	UTSW	9	90195300	missense	probably damaging	0.99
R6874:Adamts7	UTSW	9	90188731	missense	probably damaging	1.00
R6947:Adamts7	UTSW	9	90191804	splice site	probably null
R7110:Adamts7	UTSW	9	90193964	missense	possibly damaging	0.92
R7224:Adamts7	UTSW	9	90185815	missense	probably damaging	1.00
R7239:Adamts7	UTSW	9	90186557	splice site	probably null
R7519:Adamts7	UTSW	9	90197079	missense	probably benign	0.22
R7608:Adamts7	UTSW	9	90173773	missense	possibly damaging	0.68
R7635:Adamts7	UTSW	9	90195245	missense	probably damaging	1.00
R7699:Adamts7	UTSW	9	90188739	missense	probably damaging	1.00
R8519:Adamts7	UTSW	9	90193557	nonsense	probably null
R8680:Adamts7	UTSW	9	90195268	missense	probably damaging	1.00
R8743:Adamts7	UTSW	9	90195243	missense	probably damaging	0.99
R8784:Adamts7	UTSW	9	90193865	missense	probably null	0.00
R8794:Adamts7	UTSW	9	90194186	nonsense	probably null
R8851:Adamts7	UTSW	9	90193110	missense	probably benign	0.00
R9025:Adamts7	UTSW	9	90185795	nonsense	probably null
R9038:Adamts7	UTSW	9	90174639	missense
R9101:Adamts7	UTSW	9	90189741	critical splice donor site	probably null
R9256:Adamts7	UTSW	9	90178165	missense	probably damaging	1.00
R9261:Adamts7	UTSW	9	90193344	missense	probably benign	0.01
R9385:Adamts7	UTSW	9	90195205	nonsense	probably null
X0028:Adamts7	UTSW	9	90178217	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GGGCAACTGACTGATTAAACCC -3'
(R):5'- GCTCAGAATCAGATCCTACAGAG -3'

Sequencing Primer
(F):5'- CTGACTGATTAAACCCGGGGAC -3'
(R):5'- GATCCTACAGAGCCCTAAGGTTTC -3'

Posted On

2017-06-26