Incidental Mutation 'R6027:Elane'
ID480116
Institutional Source Beutler Lab
Gene Symbol Elane
Ensembl Gene ENSMUSG00000020125
Gene Nameelastase, neutrophil expressed
SynonymsNE, Ela2, F430011M15Rik
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79886247-79888215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79887018 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 86 (H86L)
Ref Sequence ENSEMBL: ENSMUSP00000038925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006679] [ENSMUST00000046091] [ENSMUST00000061653] [ENSMUST00000217837]
Predicted Effect probably benign
Transcript: ENSMUST00000006679
SMART Domains Protein: ENSMUSP00000006679
Gene: ENSMUSG00000057729

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Tryp_SPc 29 245 2.1e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000046091
AA Change: H86L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038925
Gene: ENSMUSG00000020125
AA Change: H86L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 242 3.74e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061653
SMART Domains Protein: ENSMUSP00000056836
Gene: ENSMUSG00000061780

DomainStartEndE-ValueType
Tryp_SPc 25 249 8.25e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165982
Predicted Effect probably benign
Transcript: ENSMUST00000166201
SMART Domains Protein: ENSMUSP00000129585
Gene: ENSMUSG00000057729

DomainStartEndE-ValueType
Tryp_SPc 5 125 1.26e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171489
Predicted Effect probably benign
Transcript: ENSMUST00000217837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218521
Meta Mutation Damage Score 0.9428 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the chymotrypsin-like family of serine protease enzymes that hydrolyzes a broad range of protein substrates including elastin. This gene is expressed by neutrophils where the encoded enzyme is stored in azurophil granules. Upon neutrophil activation, the active enzyme is released into the extracellular mileu. Mice lacking the encoded protein exhibit increased susceptibility to sepsis and death following intraperitoneal infection with Gram negative bacteria. This gene is located adjacent to a related proteinase gene on chromosome 10. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show impaired neutrophil physiology, susceptibility to Gram (-) bacterial infection, reduced sensitivity to xenobiotics, and abnormal local Shwartzman responses. Homozygotes for a knock-in allele show susceptibility to fungal infection and resistance to endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fam217a T A 13: 34,910,994 T170S possibly damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Elane
AlleleSourceChrCoordTypePredicted EffectPPH Score
Ruo UTSW 10 79887108 missense probably damaging 1.00
R0167:Elane UTSW 10 79887099 splice site probably null
R0639:Elane UTSW 10 79886349 missense possibly damaging 0.53
R0837:Elane UTSW 10 79887108 missense probably damaging 1.00
R2001:Elane UTSW 10 79887759 missense possibly damaging 0.90
R2425:Elane UTSW 10 79887776 missense probably benign 0.12
R4751:Elane UTSW 10 79886791 missense probably benign 0.00
R5359:Elane UTSW 10 79887036 missense probably damaging 1.00
R7565:Elane UTSW 10 79887045 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CAGGAACTTCGTCATGTCAGC -3'
(R):5'- TGACCCAGTGTGTACCTGTC -3'

Sequencing Primer
(F):5'- TCATGTCAGCAGCCCACTGTG -3'
(R):5'- CAGTGTGTACCTGTCCTGCAG -3'
Posted On2017-06-26